Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Egypt: Ramesses II temple unearthed in Upper Egypt
Adnkronos International ^ | Thursday, July 15, 2010 | AKI

Posted on 07/16/2010 7:09:40 PM PDT by SunkenCiv

Beni Suef -- Excavations in Upper Egypt's Ehnasia archaeological area in Beni-Sueif recently uncovered the remains of a 3,000 year old temple dating from the reign of ancient Egyptian pharaoh Rameses II.

"Inside the remains of this temple, excavators uncovered ten cartouches of Ramesses II and beneath them a relief saying that the ruler had built this temple for himself in Ehnasia," said the head of Egypt's Supreme Archaeology's Pharaonic Section, Sabri Abdel Aziz in a statement on Thursday.

Ramesses II ruled Egypt from 1279-1213 BC and was the son of Seti I, whose secret 'tomb within a tomb' was uncovered in June by a team of Egyptian archaeologists in the Valley of the Kings in central Egypt.

A collection of mud-brick structures dating to the fourth and fifth century AD were also found at the site of the Ramesses II era temple, according to Aziz.

A collection of terracotta statues depicting Isis, Aphrodite and Horus were found inside along with pots and clay lamps, he said.

The team of archaeologists will continue excavation of the temple during the next archaeological season, Aziz said.

Ramesses II is regarded as one of Egypt's most powerful pharaohs and was nicknamed 'the Great Ancestor' by his successors.

The famous twin temples at Abu Simbel, carved out of the rocks, the Ramesseum at Thebes, and Pi-Ramesses, a city complete with zoo near the old city of Avaris, are among the monuments built during his reign.

(Excerpt) Read more at adnkronos.com ...


TOPICS: History; Science; Travel
KEYWORDS: 19thdynasty; 26thdynasty; benisueif; egypt; godsgravesglyphs; ramesesii
Navigation: use the links below to view more comments.
first 1-5051 next last

1 posted on 07/16/2010 7:09:45 PM PDT by SunkenCiv
[ Post Reply | Private Reply | View Replies]

Egyptian archeologists comment on carbon dating While the results of Ramsey's research may present a compelling reason to revise records for the two millennia when Egypt dominated the Mediterranean world, Hawass remains categorical in his rejection of the technique: "Not even in five thousand years could carbon dating help archeology. We can use other kinds of methods like geoarcheology, which is very important, or DNA, or laser scanning, but carbon dating is useless. This science will never develop. In archeology, we consider carbon dating results imaginary."

2 posted on 07/16/2010 7:14:09 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; 21twelve; 240B; 24Karet; 2ndDivisionVet; 31R1O; 3AngelaD; ..

· join list or digest · view topics · view or post blog · bookmark · post a topic · subscribe ·

 
Gods
Graves
Glyphs
To all -- please ping me to other topics which are appropriate for the GGG list.
GGG managers are SunkenCiv, StayAt HomeMother, and Ernest_at_the_Beach
 

·Dogpile · Archaeologica · Mirabilis.ca · LiveScience · Biblical Archaeology Society ·
· Discover · Bronze Age Forum · Science Daily · Science News · Eurekalert · PhysOrg ·
· Nat Geographic · Texas AM Anthro News · Yahoo Anthro & Archaeo · Google ·
· Archaeology · The Archaeology Channel · Excerpt, or Link only? · cgk's list of ping lists ·
· History topic · history keyword · archaeology keyword · paleontology keyword ·
· Science topic · science keyword · Books/Literature topic · pages keyword · ·


3 posted on 07/16/2010 7:15:04 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

"Et cetera, et cetera, et cetera !"

4 posted on 07/16/2010 7:16:38 PM PDT by fieldmarshaldj (~"This is what happens when you find a stranger in the Amber Lamps !"~~)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

I wonder if any mention of Moses will be trashed.


5 posted on 07/16/2010 7:43:42 PM PDT by Quix (THE PLAN of the Bosses: http://www.freerepublic.com/focus/religion/2519352/posts?page=2#2)
[ Post Reply | Private Reply | To 2 | View Replies]

To: fieldmarshaldj

One of the more interesting things about Ramses the Great is he had red hair. I have no idea how they determine it but French scientists using an electron microscope were able to read DNA codes. They also say it is not just a guess. They are certain of it.

At first they found henna on his hair and thought he had dyed it red but it turned out he had just kept it it’s natural color as he aged. He clearly was not what we imagine when we think of ancient Egyptians.


6 posted on 07/16/2010 7:45:40 PM PDT by yarddog
[ Post Reply | Private Reply | To 4 | View Replies]

To: yarddog

So he was a Viking ? ;-D


7 posted on 07/16/2010 7:54:50 PM PDT by fieldmarshaldj (~"This is what happens when you find a stranger in the Amber Lamps !"~~)
[ Post Reply | Private Reply | To 6 | View Replies]

To: fieldmarshaldj

He was probably kin to the Scots and Irish. Also a Jewish friend says that King David is traditionally thought to have had red hair. All the Bible says is he had a ruddy complexion which would go along with red hair.


8 posted on 07/16/2010 8:03:51 PM PDT by yarddog
[ Post Reply | Private Reply | To 7 | View Replies]

To: SunkenCiv
Not even in five thousand years could carbon dating help archeology. .... but carbon dating is useless. This science will never develop. In archeology, we consider carbon dating results imaginary.

I have never seen an authority be so blunt about it, but his thoughts parallel with mine on that topic.

9 posted on 07/16/2010 8:25:40 PM PDT by valkyry1
[ Post Reply | Private Reply | To 3 | View Replies]

To: SunkenCiv; G8 Diplomat; nuconvert

Hawass is disturbed as he was not involved in the study as he is of the opinion that everything about Egypt has to pass him.

You can read the article here http://web.bgu.ac.il/NR/rdonlyres/55DF630A-CCFA-40CD-A069-7A0304D422C5/99415/DatingPharaonicEgyptBruinsScience2012.pdf

“The New Kingdom, which starts with the reign of Ahmose, began between about 1570 and 1544 B.C.E.”

“Finally, some common sense. Ahmose expelled the Hyksos from Egypt during the timeframe above, more than half a century after Santorini blew in 1628bce. The destruction of Minoan trade networks and the depopulation of Western Anatolia due to toxic volcanic ash allowed Hittite expansion and aggression into that area as well as their long-range sack of Babylon circa 1605bce. In other words, three super-powers bit the dust in 50 years; the Minoans, the Babylonians and the Hyksos. The new Egyptian empire would eventually regain enough strength to take on the Hittites at Qadesh and survive to tell about it.”
http://www.ishtarsgate.com/phpBB3/viewtopic.php?f=28&t=1173&p=10877


10 posted on 07/16/2010 11:40:54 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: AdmSmith

Thanks AdmSmith for the PDF. D/Led if for later.

However, the conventional pseudochronology is mistaken — the Middle Kingdom didn’t end until about 1450 BC, and the NK didn’t begin until the time of Saul; the last of the Hyksos Pharaohs was killed by the prophet Samuel, who seemed to need some psych meds most of the time. The first Babylonian period ended at the same time as the Middle Kingdom of Egypt, with the invasion of the Kassites.

Egypt was again occupied between the 18th and 19th dynasties, which were not contiguous. Ramses II lost at, and fled from, Kadesh (in this case, Carchemish), centuries after the time he had supposedly lived and died.

Haremhab’s Contemporaries
http://www.varchive.org/tac/hararch.htm

The Allies of Priam
http://www.varchive.org/dag/trowar.htm


11 posted on 07/17/2010 6:23:07 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 10 | View Replies]

To: valkyry1

Among archaeologists, Zahi is all alone in his statement; his statement is based entirely on blind belief and nationalism, with a hint of self-aggrandizement.


12 posted on 07/17/2010 6:34:45 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Quix

Moses lived nearly a thousand years before Ramses II, so there will be no mention to be trashed.


13 posted on 07/17/2010 6:35:59 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 5 | View Replies]

To: fieldmarshaldj

The “making of” extra on the DVD version I have is entertaining, on some days moreso than the movie. :’) YB was half-Mongolian, and he joked about being cast as a pharaoh.


14 posted on 07/17/2010 6:37:55 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 4 | View Replies]

To: SunkenCiv

Pharaoh Obama II

15 posted on 07/17/2010 6:41:20 AM PDT by Fresh Wind (For the first time in half a century, there is no former KKK member in the US Senate.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

I looked forward to watching the new series on Mummies on the History Channel but was so turned off by the guy you pictured that I doubt that I will watch any more follow up programs. He acted like a total jerk and if it was all an act to make it more interesting, as far as I am concerned, it failed.


16 posted on 07/17/2010 6:42:26 AM PDT by Ditter
[ Post Reply | Private Reply | To 2 | View Replies]

To: SunkenCiv
I dont see anything wrong with his statement, maybe you do. He seems to be more of an authority than anyone here or on other chat boards, so you have your opinion.

"Zahi Hawass, Egyptian archeologist and secretary-general of the Egyptian Supreme Council for Antiquities, strongly disagrees with the use of carbon dating in archeology."

“Carbon-14 dating has a margin of error of 100 years. In order to date Egyptian dynasties, we need to have specific dates; you cannot use carbon dating,” Hawass explained to Al-Masry Al-Youm. “This technique shouldn’t be used at all in making changes to the chronology of the ancient Egypt, not even as a helpful addition.”

17 posted on 07/17/2010 7:00:15 AM PDT by valkyry1
[ Post Reply | Private Reply | To 12 | View Replies]

To: Ditter

He’s got a really underdeveloped grasp of what incredulity is, and an overdeveloped sense of grandeur. :’) The old Nat Geog stuff on Egypt is much better anyway, but the DVDs generally have a second, newer program on them, featuring guess who. :’)


18 posted on 07/17/2010 7:05:30 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 16 | View Replies]

To: valkyry1

You have your opinion about Hawass’ authority; meanwhile, the article linked there merely ends with Zowie’s kooky talk, while a real (as opposed to bureaucratic) Egyptologist welcomes the study. But go ahead and saddle on Zahi Hawass’ ignorant statement because it seems to fit into some preconceived and baseless notion.


19 posted on 07/17/2010 7:13:01 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 17 | View Replies]

To: SunkenCiv

Did you watch the other night and do you know what I mean about how he treated people? I have seen him before and he didn’t act like that. Total jerk!


20 posted on 07/17/2010 7:17:01 AM PDT by Ditter
[ Post Reply | Private Reply | To 18 | View Replies]

To: SunkenCiv

And what preconceived and baseless notion will that be? Sounds like you already have the answer in the can.


21 posted on 07/17/2010 7:20:17 AM PDT by valkyry1
[ Post Reply | Private Reply | To 19 | View Replies]

To: valkyry1
As the scientist sez in the movie "Stargate", here is your authority, take a good look. You accept his authority for one thing, you must accept it for the other. If not, then he isn't an authority for you, or for anyone else. zahi hawass and jews site:freerepublic.com
Google

22 posted on 07/17/2010 7:39:49 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 21 | View Replies]

To: SunkenCiv

So that was Rameses I?

Never did keep all that straight.


23 posted on 07/17/2010 7:44:17 AM PDT by Quix (THE PLAN of the Bosses: http://www.freerepublic.com/focus/religion/2519352/posts?page=2#2)
[ Post Reply | Private Reply | To 13 | View Replies]

To: Ditter

He’s the man in charge, and he has to deal with a culture where everyone relies on family connections to get employed (I didn’t say “get work”) and expects to be able to extract squeeze money for everything or going anywhere. This is a pretty old practice, as the pharaonic tombs (including the Great Pyramid) were often open for business as tourist attractions way back in Greek and Roman times. The Great Pyramid was finally resealed late in the Roman period, then some centuries later (during Islamic times) chipped open (I guess they couldn’t find the door, or they chipped open the concrete plug the Romans had put in, no one knows; there’s a non-Egyptian bit of graffito dating from Greek or Roman times over the original door, suggesting that the Muzzies were the chippers).

And I’ll also concede that, given what Egypt is (a Moslem country), it’s a good thing they have *anyone* capable of and willing to run something like an archaeological program. There are plenty of competent Egyptologists (including some Egyptians) working in Egypt because of Hawass. He is a meddler and interferer, but even he has to be careful, because literally nothing would get dug were it not for foreign money, and those sources aren’t going to put up with just anything.

But yeah, he is a great pillock.


24 posted on 07/17/2010 7:47:21 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 20 | View Replies]

To: Quix

Thoum was the (Middle Kingdom) pharaoh of the Exodus; in the OT, his was the city Pithom (Place of Tho[u]m).


25 posted on 07/17/2010 7:53:17 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 23 | View Replies]

To: SunkenCiv
I remember hearing a few years back an Egyptian woman (I think) shrieking about the Egyptian antiques in British (and other museums) around the world. She was screaming “we were robbed these treasures belong in Egypt”. What the idiot failed to grasp is if the Brits and others hadn't intervened there wouldn't be any Egyptian antiques they would have been destroyed by Egyptians.
26 posted on 07/17/2010 7:54:40 AM PDT by Ditter
[ Post Reply | Private Reply | To 24 | View Replies]

To: Ditter

That she was able to get her ranting face on some “news” program or “documentary” shows how far gone “journalists” really are.


27 posted on 07/17/2010 7:59:01 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 26 | View Replies]

To: SunkenCiv

THX THX.
RAMESSES I WAS HIS FATHER?


28 posted on 07/17/2010 8:04:27 AM PDT by Quix (THE PLAN of the Bosses: http://www.freerepublic.com/focus/religion/2519352/posts?page=2#2)
[ Post Reply | Private Reply | To 25 | View Replies]

To: SunkenCiv

Nobody caught my transposing the character’s favorite phrase as the Siamese King Mongkut from “The King & I” onto Ramses. :-P


29 posted on 07/17/2010 2:14:50 PM PDT by fieldmarshaldj (~"This is what happens when you find a stranger in the Amber Lamps !"~~)
[ Post Reply | Private Reply | To 14 | View Replies]

To: Quix

Ramesses I was II’s father ? No. Seti was Ramesses II’s father.


30 posted on 07/17/2010 2:22:31 PM PDT by fieldmarshaldj (~"This is what happens when you find a stranger in the Amber Lamps !"~~)
[ Post Reply | Private Reply | To 28 | View Replies]

To: fieldmarshaldj

Assuming is dangerous.


31 posted on 07/17/2010 2:24:03 PM PDT by FourPeas (God Save America)
[ Post Reply | Private Reply | To 29 | View Replies]

To: FourPeas

It is ?


32 posted on 07/17/2010 2:28:19 PM PDT by fieldmarshaldj (~"This is what happens when you find a stranger in the Amber Lamps !"~~)
[ Post Reply | Private Reply | To 31 | View Replies]

To: fieldmarshaldj

Most assuredly. Lack of comment doesn’t mean not noticing.


33 posted on 07/17/2010 2:31:12 PM PDT by FourPeas (God Save America)
[ Post Reply | Private Reply | To 32 | View Replies]

To: fieldmarshaldj

No.

who was this guy’s father?

Thoum was the (Middle Kingdom) pharaoh of the Exodus;


34 posted on 07/17/2010 2:32:06 PM PDT by Quix (THE PLAN of the Bosses: http://www.freerepublic.com/focus/religion/2519352/posts?page=2#2)
[ Post Reply | Private Reply | To 30 | View Replies]

To: FourPeas

Well, you gotta speak up, son ! Let us know you’re breathing.


35 posted on 07/17/2010 2:36:51 PM PDT by fieldmarshaldj (~"This is what happens when you find a stranger in the Amber Lamps !"~~)
[ Post Reply | Private Reply | To 33 | View Replies]

To: Quix

I’m not sure who “Thoum” is, this was what I found on Wikipedia...
http://en.wikipedia.org/wiki/Pharaoh_of_the_Exodus


36 posted on 07/17/2010 2:41:46 PM PDT by fieldmarshaldj (~"This is what happens when you find a stranger in the Amber Lamps !"~~)
[ Post Reply | Private Reply | To 34 | View Replies]

To: fieldmarshaldj

THX THX.


37 posted on 07/17/2010 4:05:46 PM PDT by Quix (THE PLAN of the Bosses: http://www.freerepublic.com/focus/religion/2519352/posts?page=2#2)
[ Post Reply | Private Reply | To 36 | View Replies]

To: yarddog

well, there are bushmen and Australian aborigines who have red hair — it’s not limited to Celts. Since the Egyptians were a mixture of Berber people + Semites + Ethiopian peoples, at least initially, it would be difficult for Indo-European genes to reach them at the time of Ramssess II. For Cleopatra, that’s different as she was nearly purely Greek/Macedonian, so definitely some Celtic blood from the Galatians


38 posted on 07/18/2010 12:32:33 AM PDT by Cronos (Catholic = conservative)
[ Post Reply | Private Reply | To 6 | View Replies]

To: AdmSmith; yarddog

my error — I forgot about the Hittites who were Indo-European (they even worshipped Hindu gods like Mitra and Agni) and Mitanni.


39 posted on 07/18/2010 12:34:31 AM PDT by Cronos (Catholic = conservative)
[ Post Reply | Private Reply | To 10 | View Replies]

To: AdmSmith; yarddog

my error — I forgot about the Hittites who were Indo-European (they even worshipped Hindu gods like Mitra and Agni) like the Mitanni. Could Ramsses have had some of their blood? I would doubt it as they had appeared on the scene a few hundred years earlier and there was little reason for the EGyptian royal family to inter-marry with these strangers (philadelphus :)


40 posted on 07/18/2010 12:35:45 AM PDT by Cronos (Catholic = conservative)
[ Post Reply | Private Reply | To 10 | View Replies]

To: fieldmarshaldj

Moses, Moses...


41 posted on 07/18/2010 9:00:32 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 29 | View Replies]

To: Quix; fieldmarshaldj

Thanks.


42 posted on 07/18/2010 9:02:00 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 28 | View Replies]

To: Ditter

I saw th eshow for the first time . I agree , the guy is a jerk off and has discredited himself being attached to the once decent History Channel. That show sucked , it’s an Egyptian soap opera posing as a scientific expedition.


43 posted on 07/18/2010 8:17:07 PM PDT by sonic109
[ Post Reply | Private Reply | To 16 | View Replies]

To: fieldmarshaldj

I caught the King and I thing; I was just still reading the thread. Yul Brenner bump!


44 posted on 07/19/2010 2:40:00 PM PDT by colorado tanker
[ Post Reply | Private Reply | To 29 | View Replies]

To: SunkenCiv; Ditter
You have to admit the American director who left a newbie student on her first day on the site and his cameraman under the pyramid alone was an idiot. I don't blame Zawi going off on him, frankly.
45 posted on 07/19/2010 2:43:03 PM PDT by colorado tanker
[ Post Reply | Private Reply | To 42 | View Replies]

To: colorado tanker

Staged all staged for effect. I don’t believe a word of it. He went off on Zoe when she first arrived too, told her he didn’t want her there, then changed his mind. He was trying to add drama to it, instead he ran off people who would have watched every episode.


46 posted on 07/19/2010 2:49:20 PM PDT by Ditter
[ Post Reply | Private Reply | To 45 | View Replies]

To: Ditter
instead he ran off people who would have watched every episode

I'll give it another try, but I'm with you - I'm not interested in a show where Zawi loses his temper every five minutes.

47 posted on 07/19/2010 3:22:14 PM PDT by colorado tanker
[ Post Reply | Private Reply | To 46 | View Replies]

To: colorado tanker

Well, maybe we’ll luck out and the film crew will record the beginning of the Islamic uprising intended to overthrow the Arab Republic of Egypt — as well as the crackdown and slaughter of jihadists that follows.


48 posted on 07/20/2010 9:01:41 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 45 | View Replies]

To: SunkenCiv

I’d love to see that wuss director’s reaction to that!


49 posted on 07/21/2010 9:47:36 AM PDT by colorado tanker
[ Post Reply | Private Reply | To 48 | View Replies]

To: colorado tanker

He’d yell “cut!” — and the jihadists would be all over them with scimitars!


50 posted on 07/21/2010 4:07:56 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 49 | View Replies]


Navigation: use the links below to view more comments.
first 1-5051 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson