Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

New evolutionary research disproves living missing link theories
University of Montreal ^ | February 10, 2011 | Unknown

Posted on 02/10/2011 4:52:11 PM PST by decimon

click here to read article


Navigation: use the links below to view more comments.
first 1-5051 next last

1 posted on 02/10/2011 4:52:14 PM PST by decimon
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

Descending opinion ping.


2 posted on 02/10/2011 4:52:55 PM PST by decimon
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon

This is where I post the HT pic and say “They didn’t look too dang hard.”


3 posted on 02/10/2011 4:54:28 PM PST by bigheadfred
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon

“We did already know that most parasitic organisms had evolved to be less sophisticated than their ancestors – they lost certain abilities that they no longer needed
~~~~~~~~~~~~~~~~~~~~~~~~~~~

HUH???

How is that evolution? this must be a different phenomenon, completely separate from evolution.


4 posted on 02/10/2011 4:55:31 PM PST by mamelukesabre (Si Vis Pacem Para Bellum (If you want peace prepare for war))
[ Post Reply | Private Reply | To 1 | View Replies]

.


5 posted on 02/10/2011 5:00:13 PM PST by raygunfan
[ Post Reply | Private Reply | To 4 | View Replies]

To: mamelukesabre

>>How is that evolution?

It is political correctness applied to evolution.


6 posted on 02/10/2011 5:03:55 PM PST by Bryanw92 (We don't need to win elections. We need to win a revolution.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: decimon

Their ancestors were very sophisticated—could speak French without an accent, talk knowledgeably about wines, and solve Rubik’s cube in no time at all.


7 posted on 02/10/2011 5:25:07 PM PST by Verginius Rufus
[ Post Reply | Private Reply | To 1 | View Replies]

To: mamelukesabre
How is that evolution?

It's adaptation.

8 posted on 02/10/2011 5:26:27 PM PST by decimon
[ Post Reply | Private Reply | To 4 | View Replies]

To: raygunfan

I dissagree


9 posted on 02/10/2011 5:26:35 PM PST by mamelukesabre (Si Vis Pacem Para Bellum (If you want peace prepare for war))
[ Post Reply | Private Reply | To 5 | View Replies]

To: Verginius Rufus
Their ancestors were very sophisticated—could speak French without an accent, talk knowledgeably about wines, and solve Rubik’s cube in no time at all.

Peter Sellers?

10 posted on 02/10/2011 5:28:35 PM PST by decimon
[ Post Reply | Private Reply | To 7 | View Replies]

To: decimon

I don’t see it. It’s loss of features due to lack of use. There’s a difference.


11 posted on 02/10/2011 5:30:24 PM PST by mamelukesabre (Si Vis Pacem Para Bellum (If you want peace prepare for war))
[ Post Reply | Private Reply | To 8 | View Replies]

To: decimon

And those ancestors supposedly developed those uselss traits and such why?
It’s all bologna. God created all creatures, and we all adapted to our surroundings. The key is we are all still what we were created to be.


12 posted on 02/10/2011 5:40:56 PM PST by vpintheak (Democrats: Robbing humans of their dignity 1 law at a time)
[ Post Reply | Private Reply | To 1 | View Replies]

To: mamelukesabre
It's the best description there is. ALL genetic mutations in species involve a loss of information. Never has there ever been a mutation that included the addition of genetic information-never. Yet, the addition of information over time leading to new species is a main assumption of Darwinian evolution.

In other words—the theory of evolution is completely false.

13 posted on 02/10/2011 5:54:06 PM PST by Spudx7
[ Post Reply | Private Reply | To 4 | View Replies]

To: decimon; StayAt HomeMother; Ernest_at_the_Beach; 1010RD; 21twelve; 24Karet; 2ndDivisionVet; ...

· GGG managers are SunkenCiv, StayAt HomeMother, and Ernest_at_the_Beach ·
· join list or digest · view topics · view or post blog · bookmark · post a topic · subscribe ·

 
 Antiquity Journal
 & archive
 Archaeologica
 Archaeology
 Archaeology Channel
 BAR
 Bronze Age Forum
 Discover
 Dogpile
 Eurekalert
 Google
 LiveScience
 Mirabilis.ca
 Nat Geographic
 PhysOrg
 Science Daily
 Science News
 Texas AM
 Yahoo
 Excerpt, or Link only?
 


Thanks decimon.

To all -- please ping me to other topics which are appropriate for the GGG list.
 

· History topic · history keyword · archaeology keyword · paleontology keyword ·
· Science topic · science keyword · Books/Literature topic · pages keyword ·


14 posted on 02/10/2011 6:03:24 PM PST by SunkenCiv (The 2nd Amendment follows right behind the 1st because some people are hard of hearing.)
[ Post Reply | Private Reply | View Replies]

To: Spudx7
In other words—the theory of evolution is completely false.

The problem is with the basic laws of mathematics and probability, with which evolution is essentially incompatible. The (proportionally) biggest group of people not buying into evoloserism is mathematicians, and not Christians.

The best illustration of how stupid evolutionism really is involves trying to become some totally new animal with new organs, a new basic plan for existence, and new requirements for integration between both old and new organs.

Take flying birds for example; suppose you aren't one, and you want to become one. You'll need a baker's dozen highly specialized systems, including wings, flight feathers, a system for pivoting flight feathers so that they open on up strokes and close on down strokes, a specialized light bone structure, specialized flow-through lungs and a high efficiency heart, a specialized tail, specialized general balance parameters, a beak (since you won't have hands any more...) etc. etc. etc.

For starters, every one of these things would be antifunctional until the day on which the whole thing came together, so that the chances of evolving any of these things by any process resembling evolution (mutations plus selection) would amount to an infinitessimal, i.e. one divided by some gigantic number.

In probability theory, to compute the probability of two things happening at once, you multiply the probabilities together. That says that the likelihood of all these things ever happening at once (which is what you'd need), best case, is ten or twelve such infinitessimals multiplied together, i.e. a tenth or twelth-order infinitessimal. The whole history of the universe isn't long enough for that to happen once.

All of that was the best case. For the pieces of being a flying bird to evolve piecemeal would be much harder. In real life, natural selection could not plausibly select for hoped-for functionality, which is what would be required in order to evolve flight feathers on something which could not fly apriori. In real life, all you'd ever get would some sort of a random walk around some starting point, rather than the unidircetional march towards a future requirement which evolution requires.

And the real killer, i.e. the thing which simply kills evolutionism dead, is the following consideration: In real life, assuming you were to somehow miraculously evolve the first feature you'd need to become a flying bird, then by the time another 10,000 generations rolled around and you evolved the second such reature, the first, having been disfunctional/antifunctional all the while, would have DE-EVOLVED and either disappeared altogether or become vestigial.

Now, it would be miraculous if, given all the above, some new kind of complex creature with new organs and a new basic plan for life had ever evolved ONCE.

Evolutionism, however (the Theory of Evolution) requires that this has happened countless billions of times, i.e. an essentially infinite number of absolutely zero probability events.

And, if you were starting to think that nothing could possibly be any stupider than believing in evolution despite all of the above (i.e. that the basic stupidity of evolutionism starting from 1980 or thereabouts could not possibly be improved upon), think again. Because there is zero evidence in the fossil record to support any sort of a theory involving macroevolution, and because the original conceptions of evolution are flatly refuted by developments in population genetics since the 1950's, the latest incarnation of this theory, Steve Gould and Niles Eldredge's "Punctuated Equilibrium or punc-eek" attempts to claim that these wholesale violations of probabilistic laws all occurred so suddenly as to never leave evidence in the fossil record, and that they all occurred amongst tiny groups of animals living in "peripheral" areas. That says that some velocirapter who wanted to be a bird got together with fifty of his friends and said:

Guys, we need flight feathers, and wings, and specialized bones, hearts, lungs, and tails, and we need em NOW; not two years from now. Everybody ready, all together now:
OOOOOMMMMMMMMMMMMMmmmmmmmmmmmmmmmmmmmmmmmmmmmmm.....

You could devise a new religion by taking the single stupidest doctrine from each of the existing religions, and it would not be as stupid as THAT.

But it gets even stupider.

Again, the original Darwinian vision of gradualistic evolution is flatly refuted by the fossil record (Darwinian evolution demanded that the vast bulk of ALL fossils be intermediates) and by the findings of population genetics, particularly the Haldane dilemma and the impossible time requirements for spreading genetic changes through any sizeable herd of animals.

Consider what Gould and other punk-eekers are saying. Punc-eek amounts to a claim that all meaningful evolutionary change takes place in peripheral areas, amongst tiny groups of animals which develop some genetic advantage, and then move out and overwhelm, outcompete, and replace the larger herds. They are claiming that this eliminates the need to spread genetic change through any sizeable herd of animals and, at the same time, is why we never find intermediate fossils (since there are never enough of these CHANGELINGS to leave fossil evidence).

Obvious problems with punctuated equilibria include, minimally:

1. It is a pure pseudoscience seeking to explain and actually be proved by a lack of evidence rather than by evidence (all the missing intermediate fossils). Similarly, Cotton Mather claimed that the fact that nobody had ever seen or heard a witch was proof they were there (if you could SEE them, they wouldn't BE witches...) This kind of logic is less inhibiting than the logic they used to teach in American schools.

2. PE amounts to a claim that inbreeding is the most major source of genetic advancement in the world. Apparently Steve Gould never saw Deliverance...

3. PE requires these tiny peripheral groups to conquer vastly larger groups of animals millions if not billions of times, which is like requiring Custer to win at the little Big Horn every day, for millions of years.

4. PE requires an eternal victory of animals specifically adapted to localized and parochial conditions over animals which are globally adapted, which never happens in real life.

5. For any number of reasons, you need a minimal population of any animal to be viable. This is before the tiny group even gets started in overwhelming the vast herds. A number of American species such as the heath hen became non-viable when their numbers were reduced to a few thousand; at that point, any stroke of bad luck at all, a hard winter, a skewed sex ratio in one generation, a disease of some sort, and it's all over. The heath hen was fine as long as it was spread out over the East coast of the U.S. The point at which it got penned into one of these "peripheral" areas which Gould and Eldredge see as the salvation for evolutionism, it was all over.

The sort of things noted in items 3 and 5 are generally referred to as the "gambler's problem", in this case, the problem facing the tiny group of "peripheral" animals being similar to that facing a gambler trying to beat the house in blackjack or roulette; the house could lose many hands of cards or rolls of the dice without flinching, and the globally-adapted species spread out over a continent could withstand just about anything short of a continental-scale catastrophe without going extinct, while two or three bad rolls of the dice will bankrupt the gambler, and any combination of two or three strokes of bad luck will wipe out the "peripheral" species. Gould's basic method of handling this problem is to ignore it.

And there's one other thing which should be obvious to anybody attempting to read through Gould and Eldridge's BS:

The don't even bother to try to provide a mechanism or technical explaination of any sort for this "punk-eek"

They are claiming that at certain times, amongst tiny groups of animals living in peripheral areas, a "speciation event(TM)" happens, and THEN the rest of it takes place. In other words, they are saying:

ASSUMING that Abracadabra-Shazaam(TM) happens, then the rest of the business proceeds as we have described in our scholarly discourse above!

Again, Gould and Eldridge require that the Abracadabra-Shazaam(TM) happen not just once, but countless billions of times, i.e. at least once for every kind of complex creature which has ever walked the Earth. They do not specify whether this amounts to the same Abracadabra-Shazaam each time, or a different kind of Abracadabra-Shazaam for each creature.

15 posted on 02/10/2011 7:35:33 PM PST by wendy1946
[ Post Reply | Private Reply | To 13 | View Replies]

To: wendy1946

Very good Wendy. Very good.


16 posted on 02/10/2011 7:52:09 PM PST by 1010RD (First, Do No Harm)
[ Post Reply | Private Reply | To 15 | View Replies]

To: 1010RD
My pleasure. Evolution is mainly defended by academic dead wood and by people with lifestyle problems. Evolution is about lifestyles, and not about science.


17 posted on 02/10/2011 9:09:29 PM PST by wendy1946
[ Post Reply | Private Reply | To 16 | View Replies]

To: decimon

Well, that explains the First Sasquatch...


18 posted on 02/10/2011 9:35:28 PM PST by Publius6961 ("In 1964 the War on Poverty Began --- Poverty won.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: mamelukesabre

It’s called devolution. Liberals, for instance, devolved from conservatives.


19 posted on 02/10/2011 9:55:39 PM PST by calex59
[ Post Reply | Private Reply | To 4 | View Replies]

To: wendy1946

Great, I have tried to reply to articles about evolution with this type of conciseness but never seem to make it. I particularly love your dissection of Punctuated Equilibrium, one of the dumbest of the evolutionary theories.


20 posted on 02/10/2011 10:20:31 PM PST by calex59
[ Post Reply | Private Reply | To 15 | View Replies]

To: Spudx7; SunkenCiv; neverdem; nuconvert; decimon
ALL genetic mutations in species involve a loss of information. Never has there ever been a mutation that included the addition of genetic information-never.

Mathematically, it is the opposite. Assume a group consisting of M members and all having a specific sequence A with N characters, say A= a1a2a3...aN that is the same for all members of the group, then if you change one character for one member of the group then the information content in that changed sequence is increased. Mutations are changes in a genomic sequence, not only point mutations but as well insertions, deletions, duplications, reversions, amplifications, translocations etc.
21 posted on 02/10/2011 11:18:26 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13 | View Replies]

To: mamelukesabre
I don’t see it. It’s loss of features due to lack of use. There’s a difference.

What? Blind people have blind children because they don't use their eyes?

22 posted on 02/11/2011 2:31:25 AM PST by Bellflower (Isa 32:5 The vile person shall be no more called liberal, nor the churl said [to be] bountiful.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: mamelukesabre; raygunfan

He wasn’t talking to you. ;-p


23 posted on 02/11/2011 5:23:37 AM PST by TheOldLady ("20 Years Ago Desert Storm began...where were you...?" "I believe I was hitting it." - Lazamataz)
[ Post Reply | Private Reply | To 9 | View Replies]

To: wendy1946

Brilliant as usual. Thanks for the anti-evo ammo.


24 posted on 02/11/2011 5:33:42 AM PST by TheOldLady ("20 Years Ago Desert Storm began...where were you...?" "I believe I was hitting it." - Lazamataz)
[ Post Reply | Private Reply | To 15 | View Replies]

To: decimon

Democrats actually evolved (or devolved, if you prefer) from real human beings. Amazing!


25 posted on 02/11/2011 5:58:47 AM PST by chesley (Eat what you want, and die like a man.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: calex59; TheOldLady
On the off chance you might have missed it, The Basic Non Evolution of Modern Man.
26 posted on 02/11/2011 7:35:45 AM PST by wendy1946
[ Post Reply | Private Reply | To 20 | View Replies]

To: wendy1946

Well done!

For macro evolution to have occurred on the scale claimed by the darwinists requires more faith than reason.

The scientific community can not create on purpose what they claim occurred by accident...and yet they claim that it occurred over and over and over. New species are not created from existing ones.


27 posted on 02/11/2011 9:29:46 AM PST by killermosquito (Buffalo, Detroit (and eventually France) is what you get when liberalism runs its course.)
[ Post Reply | Private Reply | To 15 | View Replies]

To: wendy1946

Thank you. Do you have a ping list? If so, please add me. You have a way of explaining things that makes complicated intellectual and scientific arguments understandable.


28 posted on 02/11/2011 9:39:44 AM PST by TheOldLady ("20 Years Ago Desert Storm began...where were you...?" "I believe I was hitting it." - Lazamataz)
[ Post Reply | Private Reply | To 26 | View Replies]

To: decimon

“Darwin’s theory of evolution continued this idea, with the concept of a hierarchy of evolution. This way of thinking has led researchers and skeptics alike to look for less sophisticated ancestors in order to prove or disprove evolution,” Philippe explained. “What we now know is that evolution does not happen in a single direction – when people talk about a missing link, they’re generally excluding the possibility of more sophisticated ancestors.” “

—One of the things that separates Darwinism from Lamarckism and Haeckel is that it doesn’t continue with the concept of a hierarchy.

Darwin was also well aware that evolution was not directional, and that living things often became simpler instead of more complex. Many, many such cases are known. Not only is this not “new”, it’s not even uncommon. It’s particulary common among parasites.

Darwin himself studied such a case for 8 years before publishing Origin, which would become the textbook example - the barnacle. Such things are precisely what Darwin was attempting to explain, so it’s very odd to present this as “new”.

http://scienceblogs.com/evolvingthoughts/2007/02/basic_concepts_progress_primit_1.php


29 posted on 02/11/2011 9:44:38 AM PST by goodusername
[ Post Reply | Private Reply | To 1 | View Replies]

To: killermosquito; TheOldLady
For macro evolution to have occurred on the scale claimed by the darwinists requires more faith than reason.

One way of looking at it, the total sum of miracles in the Bible is probably somewhere between 30 and 100, and probably more like 30 or 40. By contrast, evolution requires an essentially infinite sequence of probabilistic miracles for every kind of creature which ever existed on the Earth i.e. a double infinity of miracles and zero-probability events.

Which is the religion? What I sometimes tell people is that you could make up a new religion by taking the single stupidest idea or doctrine from each of the existing religions and even THAT would be better than evolution.

Evolutionites within my experience are basically immune to logic but they are not immune to laughter and ridicule. What I ultimately hope to do is to teach people how to laugh at this stuff. Laughter is the one thing which no ideology can tolerate and the one thing which can ultimately get false religions like I-slam and the theory of evolution out of this world.

30 posted on 02/11/2011 9:58:49 AM PST by wendy1946
[ Post Reply | Private Reply | To 27 | View Replies]

To: wendy1946

For Plato and Aristotle laughter is an emotion involving scorn for people thought of as inferior. Plato also objects that laughter involves a loss of self-control that can lead to violence. And so in the ideal state described in his Republic and Laws, Plato puts tight restrictions on the performance of comedy.

This negative assessment of laughter, humor, and comedy influenced early Christian thinkers, who derived from the Bible a similar understanding of laughter as hostile. The classic statement of the Superiority Theory is that of Thomas Hobbes, who describes laughter as an expression of »sudden glory«.

http://webcache.googleusercontent.com/search?q=cache:ZPVj-aV4LRoJ:www.jltonline.de/index.php/articles/article/viewArticle/238/713+laughter+plato+bible&cd=11&hl=en&ct=clnk&source=www.google.com

So, we have to be careful. ;-)

Have a nice weekend


31 posted on 02/11/2011 10:55:44 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 30 | View Replies]

To: wendy1946

That is without doubt one of the best posts I’ve ever read in over 10 years on FR.


32 posted on 02/11/2011 3:22:28 PM PST by agrace
[ Post Reply | Private Reply | To 15 | View Replies]

To: wendy1946

Bump for later reference


33 posted on 02/11/2011 3:39:34 PM PST by Senator_Blutarski
[ Post Reply | Private Reply | To 15 | View Replies]

To: wendy1946

One of the best posts I have seen on this subject. Great. Thanks!


34 posted on 02/11/2011 9:52:21 PM PST by daisy mae for the usa (because)
[ Post Reply | Private Reply | To 15 | View Replies]

To: wendy1946

Very well put!


35 posted on 02/13/2011 9:50:32 PM PST by Trillian
[ Post Reply | Private Reply | To 15 | View Replies]

To: wendy1946
Well written wendy1946. Do you mind if we borrow your succinct and compelling verbiage and spread it around?

I first realized the points you point out as I was studying the theory of evolution in college as a believer in it and as an atheist. It became very hard for me to understand why others believed it any more. My Professors had no answers for my many questions but rather spoke in circles. Suffice to say it wasn't before too long that, by the grace of God, I became a saved born again believer. Hope you are too.

36 posted on 02/14/2011 1:39:32 AM PST by Bellflower (Isa 32:5 The vile person shall be no more called liberal, nor the churl said [to be] bountiful.)
[ Post Reply | Private Reply | To 15 | View Replies]

To: Bellflower
Well written wendy1946. Do you mind if we borrow your succinct and compelling verbiage and spread it around?

Feel free, that's what it's there for, but there is one big caveat: the biggest problem most people have with religion is the so-called 'problem of evil', and not evolution, and a reasonable answer to that one has to arise from logic and first principles and not from bible studies. The basic DNA/RNA code which forms the basis for all life is clearly the work of a single pair of hands. Nonetheless by the time you get to some point around 5000 - 20,000 years back on our own planet, the engineering and re-engineering of complex life forms appears to have become some sort of a cottage industry, with numerous hands involved. There is no rational way to picture an omnipotent and well-intentioned God creating ticks, chiggers, mosquitos, biting flies, disease vectors, or the myriad creatures of Pandora's box; whoever created those things is not anybody we need to worship. Likewise there is no rational way to picture an omniscient God needing to go through 100 species of horses or elephants to get to the one he wanted.

The problem of evil generally compels me to believe that God may in fact be omnipotent within his own realm, but has vanishingly little power to act in this physical realm which we inhabit. The problem seems to hang on the word 'omnipotent', and what it is supposed to mean. Defining it to mean "Having all the power which anybody can imagine" leads to conundrums; defining it to mean "Having all the power which there actually is" does not lead to conundrums.

37 posted on 02/14/2011 6:19:56 AM PST by wendy1946
[ Post Reply | Private Reply | To 36 | View Replies]

To: Bellflower
On the off chance you'd not already seen it, the thing about the supposed evolution of modern man which I posted on FR recently .
38 posted on 02/14/2011 6:25:40 AM PST by wendy1946
[ Post Reply | Private Reply | To 36 | View Replies]

To: Spudx7
Nylonase.

Before nylon was invented there was nothing for a nylonase gene to do.

After nylon was invented, they discovered a bacteria living near the water outflow of the nylon plant that had mutated an esterase enzyme so that the “new information” could now digest nylon.

A single bacteria plated and grown up into a population only has an “information set” of one. As that population is plated onto ten different plates and subjected to ten different environmental pressures, the “information set” expands through mutation, and selective pressure eliminates all but those variations that survive better to whatever pressure the population is subjected to.

Our resulting ten populations resistant to the experienced pressure now have at least ten different “information sets”, each one allowing it to survive and thrive in an environment that would kill the ancestral population.

39 posted on 02/14/2011 6:30:35 AM PST by allmendream (Tea Party did not send the GOP to D.C. to negotiate the terms of our surrender to socialism.)
[ Post Reply | Private Reply | To 13 | View Replies]

To: decimon

Semantics.

You can call it “Darwin’s theory of adaptation through natural selection of genetic variation” if you want, it changes nothing, the mechanism of change is exactly the same.


40 posted on 02/14/2011 6:31:53 AM PST by allmendream (Tea Party did not send the GOP to D.C. to negotiate the terms of our surrender to socialism.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: decimon
"The findings mean that the worms had evolved from a more sophisticated ancestor through major simplifications. "

It is amazing to me how very much of the fossil record has to do with simplifications (i.e., Eohippus).

41 posted on 02/14/2011 6:37:52 AM PST by cookcounty (Knives, Guns, Enemies and Axx-Kicks: The Gentle Political Speech of President Barrimore Soetero.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: mamelukesabre
"How is that evolution? this must be a different phenomenon, completely separate from evolution."

Not sure if I believe in Evolution, but I definitely believe in Devolution. Which are of necessity different processes. Devolution (simplifications--> the loss of information, or the loss of expression of information) is not evidence for Evolution.

The blind cave fish, or Eeohippus' losing its toes, say nothing (or at least very little) about evolution.

42 posted on 02/14/2011 6:46:24 AM PST by cookcounty (Knives, Guns, Enemies and Axx-Kicks: The Gentle Political Speech of President Barrimore Soetero.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: 1010RD; calex59; TheOldLady; killermosquito; AdmSmith; agrace; Senator_Blutarski; ...

A couple of people have suggested that FR could use some sort of an anti-evolution ping list... Anybody wishing to be added to the list should notify me via freepmail.


43 posted on 02/14/2011 8:55:12 AM PST by wendy1946
[ Post Reply | Private Reply | To 42 | View Replies]

To: wendy1946

I don’t think you should create an anti-evolution ping list. I think you should create an anti-macro-evolution ping list and the distinction is an important one. Or perhaps an intelligent design ping list which I would favor.

Add me to your list. Thank you.


44 posted on 02/14/2011 9:34:18 AM PST by killermosquito (Buffalo, Detroit (and eventually France) is what you get when liberalism runs its course.)
[ Post Reply | Private Reply | To 43 | View Replies]

To: wendy1946

Unless there is a purpose to evil. It seems that faith as it applies to religion and thus to life, is more important than knowledge. At least that’s the message of Christianity.


45 posted on 02/14/2011 10:19:50 AM PST by 1010RD (First, Do No Harm)
[ Post Reply | Private Reply | To 37 | View Replies]

To: cookcounty

An Evolutionist would say that you’d expect just such a flux there being times when a more “sophisticated” genetic make up was more favorable and other times/environments in which a simpler form was needed.


46 posted on 02/14/2011 10:30:45 AM PST by 1010RD (First, Do No Harm)
[ Post Reply | Private Reply | To 41 | View Replies]

To: wendy1946

Thank you for including me, please keep my name on your list.


47 posted on 02/14/2011 10:46:40 AM PST by agrace
[ Post Reply | Private Reply | To 43 | View Replies]

To: wendy1946
A couple of people have suggested that FR could use some sort of an anti-evolution ping list... Anybody wishing to be added to the list should notify me via freepmail.

Please sign me up. Thanks Wendy!

48 posted on 02/14/2011 10:46:56 AM PST by Senator_Blutarski
[ Post Reply | Private Reply | To 43 | View Replies]

To: 1010RD
I'm not into pushing religion of any sort. I'll RECOMMEND Christianity if somebody WANTS a recommendation, but even Voodoo and Rastafari are better than evolution: neither Voodoo nor Rastafari requires any sort of a belief in a trans-finite sequence of probabilistic miracles and neither Voodoo nor Rastafari has two world wars or 300,000,000 dead bodies lying around on account of it.

Evolution is junk science and as junk science goes, a spectacularly pernicious and dangerous flavor of it. Evolution was the philosophical corner stone of Nazism and Communism and the various eugenics movements. Worse, despite its having been thoroughly debunked over the last 100 years, its adherents still dominate discussions of it by sheer weight of numbers and decibel level.

You even see that on conservative forums like FR and in fact the argument you generally see is "Hey, you're making all of us (conservatives) look like kooks (by saying anything about evolution) and, funny thing, evolutionism appears to transcend left/right barriers. The evolutionist postings you see on FR or the Limbaugh or Coulter forums are basically indistinguishable from those you'd see on DU or anything else like that.

49 posted on 02/14/2011 10:50:21 AM PST by wendy1946
[ Post Reply | Private Reply | To 45 | View Replies]

To: Senator_Blutarski; wendy1946

I vote for a lamarckian evolution ping list.


50 posted on 02/14/2011 11:01:42 AM PST by mamelukesabre (Si Vis Pacem Para Bellum (If you want peace prepare for war))
[ Post Reply | Private Reply | To 48 | View Replies]


Navigation: use the links below to view more comments.
first 1-5051 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson