Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

How to go out with a bang score points for censorship (Science Journal EDITOR resigns)
JoNova ^ | September 5th, 2011 | Joanne

Posted on 09/05/2011 12:34:03 PM PDT by Ernest_at_the_Beach

Full Title:

How to go out with a bang — score points for censorship — a poseur for honor!

An editor has resigned after committing the dastardliest of crimes: He helped publish a skeptical paper in a peer-reviewed journal. God-forbid, imagine a paper being reviewed only by people who have some sympathies with your results? It’s unthinkable. We all know that Nature and Science, for example, dutifully send all the papers by alarmists to at least one skeptical reviewer, and since 97% of 77 climate scientists are alarmists, that means the other two scientists who aren’t, are very busy people.  (75 of 77 climate scientists “agree” that the world is going to hell because of CO2). And who knows where they found that third skeptic?

Naturally, lots of journal editors have resigned when they’ve realized that, accidentally, they’ve only sent alarmist papers to alarmist reviewers.

As if we needed reminding about how bizarre, unbalanced, and unscientific is the creed of climate. Normally, if egregious mistakes are found, a paper would be retracted. If “normal” mistakes are found, those who found them could publish something called  a “reply”. This resignation appears to be a first. Wagner chucked his job without even so much as phoning Spencer or Braswell, which makes you wonder if it was all a bit convenient.

To the editors who are thinking of resigning from peer-reviewed journals, or finishing up as presidents of Science Associations, or winding up their position at a government funded institution, instead of just resigning, why not go out with a bang? You too, could quit, and leave a blockbuster-press-release-for-the-cause, pretending that  (insert spurious reason) provoked you into going.

See, it’s really handy — Roy Spencer and William Braswell have a paper out there that’s peer reviewed, but very difficult to answer, Wolfgang Wagner has provided the perfect reply: That paper was so bad that the editor of the journal quit because it was published. See, no one needs to discuss the evidence in it now; they can just pour scorn, and talk about the editor resigning, case closed, it’s obviously a crap paper you know. Brilliant!

*Me. Of course, I’ve got no evidence, or even a hint that Mr Wagner was thinking of resigning anyway, but if he wasn’t and he really did resign over this, it’s all the more pathetic — like a cult victim sacrifice. In which case we ought be feeling sorry for poor old Wagner, who has been got too, excommunicated from his peer group for accidentally letting through an evil paper.

The former editor’s reasons:

…In other words, the problem I see with the paper by Spencer and Braswell is not that it declared a minority view (which was later unfortunately much exaggerated by the public media) but that it essentially ignored the scientific arguments of its opponents. This latter point was missed in the review process, explaining why I perceive this paper to be fundamentally flawed and therefore wrongly accepted by the journal

Roy Spencer replies:

But the paper WAS precisely addressing the scientific arguments made by our opponents, and showing why they are wrong! That was the paper’s starting point! We dealt with specifics, numbers, calculations…while our critics only use generalities and talking points. There is no contest, as far as I can see, in this debate. If you have some physics or radiative transfer background, read the evidence we present, the paper we were responding to, and decide for yourself.

Normally, if people think something is wrong with a paper they just write a reply…

If some scientists would like do demonstrate in their own peer-reviewed paper where *anything* we wrote was incorrect, they should submit a paper for publication. Instead, it appears the IPCC gatekeepers have once again put pressure on a journal for daring to publish anything that might hurt the IPCC’s politically immovable position that climate change is almost entirely human-caused. I can see no other explanation for an editor resigning in such a situation.

But the problem with Spencer and Braswell might be the way others are using their paper:

“I would also like to personally protest against how the authors and like-minded climate sceptics have much exaggerated the paper’s conclusions in public statements”

Perhaps the real problem wasn’t the scientific credence this paper lends to skeptics (since there are hundreds of paper on that list) but that this one paper made the mistake of generating headlines around the world.

Unfortunately, their campaign [Spencer and Braswell's campaign to publicize the availability of their paper] apparently was very successful as witnessed by the over 56,000 downloads of the full paper within only one month after its publication.

Skeptics, this tactic will only work if we allow it to dull the impact of the real meaning of Spencer and Braswell. Go forth and comment, on news articles and other sites, make sure everyone knows that the Global Warming Thought Police are desperate to stop people talking about the evidence.

That paper:

Spencer, R.W.; Braswell, W.D. On the misdiagnosis of surface temperature feedbacks from variations in Earth’s radiant energy balance. Remote Sens. 2011, 3, 1603-1613.

Thanks to Alec Rawls on WUWT for one of the quotes from the editor.

Disko Troop on WUWT says:

I see this as a more carefully worded resignation than some are seeing. The contradictions are deliberate. He is saying that he did his job, the respected peer reviewers did theirs, but that he is being forced to deny this fact by agencies or persons beyond his control. His response is to resign rather than retract what he sees as a perfectly justifiable publication of Spencers Observations.
The nett result will be another 56,000 people downloading the paper to see what the fuss is about . Team fail.

The short killer summary: The Skeptics Handbook. The most deadly point: The Missing Hot Spot.



TOPICS: Astronomy; Conspiracy; Science; Weather
KEYWORDS: agw; braswell; catastrophism; climatechange; globalhoaxing; globalwarmingerror; globalwarminghoax; greenreligion; ipcc; junkscience; orwelliannightmare; pravdamedia; pseudoscience; royspencer; spencer; stringtheory; thebiglie; thegreenmenace; thougthtcrime; watermelons

1 posted on 09/05/2011 12:34:08 PM PDT by Ernest_at_the_Beach
[ Post Reply | Private Reply | View Replies]

To: TigerLikesRooster; landsbaum; Signalman; NormsRevenge; steelyourfaith; Lancey Howard; ...
75 Responses to “How to go out with a bang — score points for censorship — a poseur for honor!”
2 posted on 09/05/2011 12:35:51 PM PDT by Ernest_at_the_Beach ( Support Geert Wilders)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Ernest_at_the_Beach

WHy shouldn’t they ignore their opponents?


3 posted on 09/05/2011 12:44:46 PM PDT by GeronL (The Right to Life came before the Right to Happiness)
[ Post Reply | Private Reply | To 1 | View Replies]

To: All
From the comments:

************************EXCERPT************************************

#1:

Sean:

I’ve heard that the editor of Remote Sensing sent a personal letter of apology to Kevin Trenberth over the publication of the Spencer Braswell paper. It’s not the first resignation inspired by Dr. Trenbreth. Steve Goddard’s site has the letter that Chris Landsea sent to the IPCC several years ago because of the miss characterization of the hurricane frequency and intensity as a result of climate change. http://www.real-science.com/uncategorized/kevin-trenberth-master-ipcc-junk-science He specifically mentions hyping the results in a press conference by people (Trenberth) who did not have the expertise to make such claims. “I found it a bit perplexing that the participants in the Harvard press conference had come to the conclusion that global warming was impacting hurricane activity today. To my knowledge, none of the participants in that press conference had performed any research on hurricane variability, nor were they reporting on any new work in the field. All previous and current research in the area of hurricane variability has shown no reliable, long-term trend up in the frequency or intensity of tropical cyclones, either in the Atlantic or any other basin. The IPCC assessments in 1995 and 2001 also concluded that there was no global warming signal found in the hurricane record.” Trenberth has become a one man wrecking crew of scientific integrity.

4 posted on 09/05/2011 12:59:50 PM PDT by Ernest_at_the_Beach ( Support Geert Wilders)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Ernest_at_the_Beach

Trenberth seems to be at the center of the CAGW cabal linking English and American academics along with gov’t scientific centers.


5 posted on 09/05/2011 1:04:35 PM PDT by Paladin2
[ Post Reply | Private Reply | To 4 | View Replies]

To: Ernest_at_the_Beach
And #3 comment:

**************************EXCERPT*******************************************

Jaymez:

If the climate alarmists can’t control the popular press, they will try harder to control the scientific press. This was evidenced before in the Climategate emails and here in Australia with the CSIRO re-interpreting research results released by their own scientists to reduce any possibility the IPCC orthodoxy is brought into question.

The peer review process in climate science is operating like our real estate industry where practitioners will always tell you it’s a great time to buy regardless of the evidence to the contrary. The state based REal Estate Institutes only report settled sales, they don’t report how many properties are taken off the market after failing to sell.

Sales prices are tracked and graphed without adjusting for the fact hundreds of thousands of dollars can be spent on renovation, additions and upgrades and thousands of dollars are spent on maintenance, rates, taxes,stamp duties and selling fees by the owners, thus dramatically reducing the actual return on investment. Consequently the real estate industry property market charts always show a higher capital growth rate than is ever actually achieved by the market.

They can also make property slumps disappear. Sound familiar?

Climate scientists are becoming the real estate agents of the science world willing to sell human induced catastrophic climate change no matter what the evidence.

6 posted on 09/05/2011 1:04:40 PM PDT by Ernest_at_the_Beach ( Support Geert Wilders)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Paladin2

He was also an understudy to Dr. James Hansen of GISS.


7 posted on 09/05/2011 1:06:53 PM PDT by Ernest_at_the_Beach ( Support Geert Wilders)
[ Post Reply | Private Reply | To 5 | View Replies]

To: Ernest_at_the_Beach

They should all hang together.


8 posted on 09/05/2011 1:08:33 PM PDT by Paladin2
[ Post Reply | Private Reply | To 7 | View Replies]

To: Ernest_at_the_Beach; SteamShovel; Bockscar; Thunder90; rdl6989; marvlus; Fractal Trader; ...
Thanx for the ping Ernest_at_the_Beach !

 


Beam me to Planet Gore !

9 posted on 09/05/2011 1:17:05 PM PDT by steelyourfaith (If it's "green" ... it's crap !!!)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Ernest_at_the_Beach
"How to go out with a bang — score points for censorship — a poseur for honor! "

the world is Heresy

10 posted on 09/05/2011 1:17:34 PM PDT by Steve Van Doorn (*in my best Eric Cartman voice* 'I love you, guys')
[ Post Reply | Private Reply | To 1 | View Replies]

To: Ernest_at_the_Beach
oops:
the word is Heresy
11 posted on 09/05/2011 1:18:33 PM PDT by Steve Van Doorn (*in my best Eric Cartman voice* 'I love you, guys')
[ Post Reply | Private Reply | To 1 | View Replies]

To: Ernest_at_the_Beach
Mor frrom the comments:

**************************EXCERPT*****************************************

Elsabio:
If anyone is interested in reading the egregious study, you can download it here [.pdf]. The more people who download it the better, but do so now before it is disappeared.

12 posted on 09/05/2011 1:19:36 PM PDT by Ernest_at_the_Beach ( Support Geert Wilders)
[ Post Reply | Private Reply | To 7 | View Replies]

To: Ernest_at_the_Beach
More:

**********************************EXCERPT****************************************

Bruce of Newcastle:

I’ll add that Prof Pielke Snr has a new post which excoriates the MSM article by Drs Trenberth, Gleike and Abraham:

“What is disturbing, however, in the Trenberth et al article is its tone and disparagement of two outstanding scientists.

Instead of addressing the science issues, they resort to statements such as Spencer and Christy making “serial mistakes”. This is truly a hatchet job and will only further polarize the climate science debate.”

If they can’t explain in a blog article where the science is wrong then it is probably because it is pretty right. That is the impression I get from Prof Pielke – who famously lists in great detail all the science papers which show why if there IS something wrong. He would not have held back regarding Dr Spencer’s paper if that were the case. Instead he calls Drs Spencer & Christy “two outstanding scientists”. Hard to better that vote of confidence.

13 posted on 09/05/2011 1:25:39 PM PDT by Ernest_at_the_Beach ( Support Geert Wilders)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Ernest_at_the_Beach

Yeah, but check out some comments on WUWT and see where the editor’s “day job” was. “Hockey Stick” Mann and “Perpetually Offended” Trenberth both hold sway over the boards or companies where he’s gainfully employed.

Not surprising at all that he caved, apologized to Trenberth and resigned. Apparently, the board of the publication wouldn’t back him in rescinding the Spencer paper after Trenberth et al gave him his marching orders.

What an incestuous, grade-school mentality these AGW proponents share. “Scientist” is one term that cannot be applied to them.


14 posted on 09/05/2011 1:49:04 PM PDT by hadit2here ("Most men would rather die than think. Many do." - Bertrand Russell)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Ernest_at_the_Beach
I got my copy, not taking any chance that it would "disappear."
15 posted on 09/05/2011 2:25:24 PM PDT by JoeFromSidney (New book: RESISTANCE TO TYRANNY. A primer on armed revolt. Available form Amazon.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Ernest_at_the_Beach
Sound familiar?

Like 0bama's unemployment statistics.

16 posted on 09/05/2011 2:40:17 PM PDT by reg45
[ Post Reply | Private Reply | To 6 | View Replies]

To: hadit2here

Thanks for that update!


17 posted on 09/05/2011 3:01:17 PM PDT by Ernest_at_the_Beach ( Support Geert Wilders)
[ Post Reply | Private Reply | To 14 | View Replies]

To: Ernest_at_the_Beach; AdmSmith; bvw; callisto; ckilmer; dandelion; ganeshpuri89; gobucks; ...

Thanks Ernest. A very general sidebar:
Somebody back then had the bright idea that, if peer reviewers were anonymous and free from accountability, they would be more candid and more truthful. For about five decades, ...NSF, NASA and other agencies have been doing what no foreign adversary or terrorist organization has been able to do: They have been slowly and imperceptibly undermining American science, driving America toward third-world status in science. Secret, unaccountable reviews - frequently by one's competitors - give unfair advantage to reviewers who would falsely berate a competitor's proposal for research funds... The system has been to open to corruption for decades, and remains open to further corruption... There is a far, far more devastating consequence of secret, unaccountable reviews: Out of fear of being "denounced" in secret reviews, many scientists have become pale-gray, defensive, adopting only the consensus-approved viewpoint and refraining from discussing anything that might be considered a challenge to other's work or to the funding agency's programs. Political correctness is the order. -- Alvarez by Luis Alvarez (page 184)

I must reiterate my feeling that experimentalists always welcome the suggestions of the theorists. But the present situation is ridiculous... In my considered opinion the peer review system, in which proposals rather than proposers are reviewed, is the greatest disaster to be visited upon the scientific community in this century. No group of peers would have approved my building the 72-inch bubble chamber. Even Ernest Lawrence told me that he thought I was making a big mistake. He supported me because my track record was good. I believe U.S. science could recover from the stultifying effects of decades of misguided peer reviewing if we returned to the tried-and-true method of evaluating experimenters rather than experimental proposals. Many people will say that my ideas are elitist, and I certainly agree. The alternative is the egalitarianism that we now practice and that I've seen nearly kill basic science in the USSR and in the People's Republic of China. -- ibid (pp 200-201)

18 posted on 09/05/2011 6:48:48 PM PDT by SunkenCiv (It's never a bad time to FReep this link -- https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | View Replies]


I pinged two lists in the earlier post, here's the actual logos and stuff:


· String Theory Ping List ·
Bitch Slap, nope, Newton, Third Law
· Join · Bookmark · Topics · Google ·
· View or Post in 'blog · post a topic · subscribe ·


19 posted on 09/05/2011 6:49:26 PM PDT by SunkenCiv (It's never a bad time to FReep this link -- https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv; All

The Alvarez family certainly learned about academic orthodoxy when the tried to convince the world of their boloid impact theory for the death of the dinosaurs. I am glad to see that a few scientists are actually beginning to ignore the orthodoxy that has restricted archeological quests to areas mostly above sea level. With water as low as 400 feet below current sea levels in the past 18,000 years, there is so much potential for exploration.


20 posted on 09/05/2011 8:57:28 PM PDT by gleeaikin
[ Post Reply | Private Reply | To 18 | View Replies]

To: Ernest_at_the_Beach; SunkenCiv

Comments by Lubos Motl:

The consensus scientists and Greenpeace members who believe that the judgement day is approaching were not pleased by the publication of a paper by Spencer and Braswell. In fact, they forced the editor of the journal to resign.

Finally, they found the answer: they decided to publish their own paper, one that rejects the basic assumptions of Spencer and Braswell. And they agreed that the paper should be published much more quickly than any other paper – they should circumvent the usual multi-month delays – because it was totally urgent and critical for the survival of life on Earth to show that Spencer’s and Braswell’s paper was totally unimportant.

http://motls.blogspot.com/2011/09/andrew-dessler-clouds-dont-reflect.html


21 posted on 09/06/2011 3:40:44 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

BTTT


22 posted on 09/06/2011 10:09:36 AM PDT by I got the rope
[ Post Reply | Private Reply | To 18 | View Replies]

To: Ernest_at_the_Beach
Normally, if people think something is wrong with a paper they just write a reply…

Well, yeah. But the reply is ad hominem rather than to the facts.

23 posted on 09/06/2011 3:55:19 PM PDT by AndrewC
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv; Ernest_at_the_Beach

Publish-or-perish: Peer review and the corruption of science

~snip~

So what can be done about scientific publishing? The only service the publishers provide is to arrange for reviews and to print the journals. And for this they charge an exorbitant fee, a racket George Monbiot rightly calls "pure rentier capitalism".

There is an alternative: publish your paper yourself on the web and open the comments. This sort of post-publication review would reduce costs enormously, and the results would be open for anyone to read without paying. It would also destroy the hegemony of half a dozen high-status journals. Everyone wants to publish in Nature, because it's seen as a passport to promotion and funding. The Nature Publishing Group has cashed in by starting dozens of other journals with Nature in the title.

~snip~

The chicanery is not limited to "climate change" but is pervasive in most if not all fields of study. Fudging the data is not the sole purview of algore and his fellow travelers.

24 posted on 09/06/2011 10:09:43 PM PDT by ForGod'sSake (You have only two choices: SUBMIT or RESIST with everything you've got!!!)
[ Post Reply | Private Reply | To 18 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson