Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

All patents are theft
Linux User & Developer ^ | 25 October 2011 | Richard Hillesley

Posted on 10/26/2011 7:30:09 AM PDT by ShadowAce

If necessity is the mother of invention, patents are its delinquent offspring, providing stumbling blocks to innovation and progress, inhibiting the free exchange of ideas, and restricting our knowledge of how things work, says Richard Hillesley…

Pablo Picasso is supposed to have said that “all art is theft”. The assertion may be controversial, but the intention is clear – the creative process, which relies on the evolution of techniques, observation and criticism, is an assimilation of that which has gone before, and all creativity, whether artistic, technological or scientific, walks a thin line between innovation and originality, plagiarism and parody. Even the idea that art is theft is a common place among artistic communities. Andy Warhol took this concept a few stages further. During a 1966 interview he told his interviewer; “Why don’t you ask my assistant Gerard Malanga some questions? He did a lot of my paintings.”

Linus Torvalds himself noted in another context, when rebutting arguments against open source by Craig Mundie, Microsoft’s senior vice president in May 2001, “I wonder if Mundie has ever heard of Sir Isaac Newton? [Newton] is not only famous for having basically set the foundations for classical mechanics (and the original theory of gravitation, which is what most people remember, along with the apple tree story), but he is also famous for how he acknowledged the achievement: ‘If I have been able to see further, it was only because I stood on the shoulders of giants.’”

Newton’s remark was intended as a derogatory comment in the margins of a letter to his diminutive contemporary, the scientist Robert Hooke, and was not an original observation, but tells a wider truth, that the creative process and the discovery of ideas is very seldom the product of one man’s work in isolation, but an accumulation of what has gone before.

Much of modern intellectual thought has defined itself by questioning the rites of authorship, authenticity and identity. This paradox lies at the heart of the debate about ‘Intellectual Property Rights’ and the ‘ownership’ of ideas – a debate in which the Linux and free software movement has found itself embroiled, directly through the patents crisis and the convolutions of copyright law, and less directly through its relationship with the Net.

Free software has been successful way beyond the expectations of its proponents and its detractors, appealing to a far wider audience than might have been predicted, but as Richard Stallman is quick to remind us, there is still some way to go: “The only reason we have a wholly free operating system,” he has said, “is because of the movement that said ‘we want an operating system that is wholly free, not 90 per cent free.’ If you don’t have freedom as a principle, you can never see a reason not to make an exception. There are constantly going to be times when for one reason or another there’s some practical convenience in making an exception.”

By its very nature free software challenges modern conventions of ownership, and its continuing existence and the blossoming of ideas that free software represents, is directly threatened by the extension and proliferation of trivial and contestable patents over the last two or three decades.

Software uses language as a means of interacting with the millions of on and off switches that comprise a computer. The sets of instructions that are contained in a computer language, or any other computer program, rely on basic structures that are common to all computer languages, and have evolved over half a century of shared development.

The most famous expression of this truth was provided by Bill Gates in a Microsoft internal ‘Challenges and Strategy’ memo, dated May 16,1991. “If people had understood how patents would be granted when most of today’s ideas were invented and had taken out patents”, he wrote, “the industry would be at a complete stand-still today.”

Rather more revealingly, Gates concluded that the “solution” to the problem of patents was “patenting as much as we can… A future start-up with no patents of its own will be forced to pay whatever price the giants choose to impose. That price might be high: Established companies have an interest in excluding future competitors.”

Just one of the many compelling arguments against patents for software, as in other parts of our lives, is that invention and innovation in software is cumulative, and depends entirely on the efforts of others who have gone before – and that this will continue to be the case with every small development in the field of programming. Good programmers invent new processes every day, and other good programmers use these processes to make further inventions. That is, and always has been, the nature of the job. To assign patents to these small inventions, which are effectively expressions of speech, is to stop innovation in its tracks. This matters because code runs our lives. As Lawrence Lessig puts it: “These machines run us. Code runs these machines. What control should we have over this code?”

If necessity is the mother of invention, patents are its delinquent offspring, providing stumbling blocks to innovation and progress, inhibiting the free exchange of ideas, and restricting our knowledge of how things work.


TOPICS: Computers/Internet
KEYWORDS: patents; software
Navigation: use the links below to view more comments.
first 1-5051-68 next last

1 posted on 10/26/2011 7:30:13 AM PDT by ShadowAce
[ Post Reply | Private Reply | View Replies]

To: rdb3; Calvinist_Dark_Lord; GodGunsandGuts; CyberCowboy777; Salo; Bobsat; JosephW; ...

2 posted on 10/26/2011 7:32:06 AM PDT by ShadowAce (Linux -- The Ultimate Windows Service Pack)
[ Post Reply | Private Reply | To 1 | View Replies]

Comment #3 Removed by Moderator

To: ShadowAce
Take it up with out founding fathers then, of the very few limited and enumerated powers given to Congress by our Constitution is the granting of patents.

They have the intended effect the founders envisioned, that being the promotion of the useful arts and sciences.

Hardcore socialists believe intellectual property, like physical personal property - should be abolished.

That is not typically the American view.

4 posted on 10/26/2011 7:35:32 AM PDT by allmendream (Tea Party did not send the GOP to D.C. to negotiate the terms of our surrender to socialism.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: allmendream

Franklin freely gave many of his inventions to the world but he did not seek to force others to do the same.


5 posted on 10/26/2011 7:41:04 AM PDT by cripplecreek (A vote for Amnesty is a vote for a permanent Democrat majority. ..Choose well.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: ShadowAce
PATENTING LIFE

By MICHAEL CRICHTON

Published: February 13, 2007

YOU, or someone you love, may die because of a gene patent that should never have been granted in the first place. Sound far-fetched? Unfortunately, it’s only too real.

Gene patents are now used to halt research, prevent medical testing and keep vital information from you and your doctor. Gene patents slow the pace of medical advance on deadly diseases. And they raise costs exorbitantly: a test for breast cancer that could be done for $1,000 now costs $3,000.

Why? Because the holder of the gene patent can charge whatever he wants, and does. Couldn’t somebody make a cheaper test? Sure, but the patent holder blocks any competitor’s test. He owns the gene. Nobody else can test for it. In fact, you can’t even donate your own breast cancer gene to another scientist without permission. The gene may exist in your body, but it’s now private property.

This bizarre situation has come to pass because of a mistake by an underfinanced and understaffed government agency. The United States Patent Office misinterpreted previous Supreme Court rulings and some years ago began — to the surprise of everyone, including scientists decoding the genome — to issue patents on genes.

Humans share mostly the same genes. The same genes are found in other animals as well. Our genetic makeup represents the common heritage of all life on earth. You can’t patent snow, eagles or gravity, and you shouldn’t be able to patent genes, either. Yet by now one-fifth of the genes in your body are privately owned.

The results have been disastrous. Ordinarily, we imagine patents promote innovation, but that’s because most patents are granted for human inventions. Genes aren’t human inventions, they are features of the natural world. As a result these patents can be used to block innovation, and hurt patient care.

For example, Canavan disease is an inherited disorder that affects children starting at 3 months; they cannot crawl or walk, they suffer seizures and eventually become paralyzed and die by adolescence. Formerly there was no test to tell parents if they were at risk. Families enduring the heartbreak of caring for these children engaged a researcher to identify the gene and produce a test. Canavan families around the world donated tissue and money to help this cause.

When the gene was identified in 1993, the families got the commitment of a New York hospital to offer a free test to anyone who wanted it. But the researcher’s employer, Miami Children’s Hospital Research Institute, patented the gene and refused to allow any health care provider to offer the test without paying a royalty. The parents did not believe genes should be patented and so did not put their names on the patent. Consequently, they had no control over the outcome.

In addition, a gene’s owner can in some instances also own the mutations of that gene, and these mutations can be markers for disease. Countries that don’t have gene patents actually offer better gene testing than we do, because when multiple labs are allowed to do testing, more mutations are discovered, leading to higher-quality tests.

Apologists for gene patents argue that the issue is a tempest in a teapot, that patent licenses are readily available at minimal cost. That’s simply untrue. The owner of the genome for Hepatitis C is paid millions by researchers to study this disease. Not surprisingly, many other researchers choose to study something less expensive.

But forget the costs: why should people or companies own a disease in the first place? They didn’t invent it. Yet today, more than 20 human pathogens are privately owned, including haemophilus influenza and Hepatitis C. And we’ve already mentioned that tests for the BRCA genes for breast cancer cost $3,000. Oh, one more thing: if you undergo the test, the company that owns the patent on the gene can keep your tissue and do research on it without asking your permission. Don’t like it? Too bad.

The plain truth is that gene patents aren’t benign and never will be. When SARS was spreading across the globe, medical researchers hesitated to study it — because of patent concerns. There is no clearer indication that gene patents block innovation, inhibit research and put us all at risk.

Even your doctor can’t get relevant information. An asthma medication only works in certain patients. Yet its manufacturer has squelched efforts by others to develop genetic tests that would determine on whom it will and will not work. Such commercial considerations interfere with a great dream. For years we’ve been promised the coming era of personalized medicine — medicine suited to our particular body makeup. Gene patents destroy that dream.

Fortunately, two congressmen want to make the full benefit of the decoded genome available to us all. Last Friday, Xavier Becerra, a Democrat of California, and Dave Weldon, a Republican of Florida, sponsored the Genomic Research and Accessibility Act, to ban the practice of patenting genes found in nature. Mr. Becerra has been careful to say the bill does not hamper invention, but rather promotes it. He’s right. This bill will fuel innovation, and return our common genetic heritage to us. It deserves our support.

6 posted on 10/26/2011 7:41:04 AM PDT by E. Pluribus Unum ("Government does not solve problems; it subsidizes them." --Ronald Reagan)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ShadowAce

I’m a software engineer, so I have a particular view on this.

What I always wonder is “who feeds all this free labor?”.

Think about it.

Its not surprising that a lot of it is European.

Anyway, it makes for some interesting business models.

One thing I notice, and this is probably unavoidable, is that a lot of open source stuff is not wel documented from the user’s persepctive. It’s one thing to get people willing to donate time in the hope of making a name f or themselves. But there aren’t so many volunteers when it comes to the glory-free chore of documentation.


7 posted on 10/26/2011 7:41:13 AM PDT by Pessimist
[ Post Reply | Private Reply | To 1 | View Replies]

To: allmendream
Personally, I don't have a problem with the idea of patents.

I do, however, have a problem with the length of time for which they are granted.

8 posted on 10/26/2011 7:41:13 AM PDT by ShadowAce (Linux -- The Ultimate Windows Service Pack)
[ Post Reply | Private Reply | To 4 | View Replies]

To: ShadowAce

Sounds like just another liberal that isn’t making much money on his software and wants to blame everyone else for it.


9 posted on 10/26/2011 7:46:22 AM PDT by CodeToad (Islam needs to be banned in the US and treated as a criminal enterprise.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ShadowAce

A Patent is a hunting license for investment capital, not a reward for scientific achievement.


10 posted on 10/26/2011 7:48:21 AM PDT by Andy from Chapel Hill
[ Post Reply | Private Reply | To 1 | View Replies]

To: ShadowAce

Rather broad brush you have there!

Let’s get rid of copyrights, too.

How about land ownership and home ownership?

All depend on the principle of “I got here first and worked to make this idea/place/thing better.”

The left loves “artists, writers & musicians” and grants them intellectual property rights far exceeding those given to the more plebeian mechanics, builders & engineers.

A copyright is for the lifetime of the author plus 70 years. A patent is for 20 years from the filing date of the patent application. Not much time to develop an industry & market your product.

If the author opposes patents just let him develop freeware only. With intellectual property which can easily be copied & distributed for little or no cost, he will have to depend on philanthropy for his income.

Plant an orchard. Prune it & tend it. Come harvest time, let anyone walking by pick (and sell) as much as they want. Great idea? Probably not.


11 posted on 10/26/2011 7:54:05 AM PDT by BwanaNdege (“Man has often lost his way, but modern man has lost his address” - Gilbert K. Chesterton)
[ Post Reply | Private Reply | To 1 | View Replies]

To: allmendream

Article I, Section 8, Clause 8 of the United States Constitution, known as the Copyright Clause, empowers the United States Congress: “To promote the Progress of Science and useful Arts, by securing for limited Times to Authors and Inventors the exclusive Right to their respective Writings and Discoveries.”

As usual, the Founders were prescient. This was, I believe, the first time in history when an ordinary person could routinely receive a patent or copyright for the exclusive use of his invention or writings. Previous patents and copyrights had largely been given as an act of favor by a king to nobles or others with connections.

As you might imagine, it has contributed greatly to the advancement of knowledge and invention.

However.

It has been stretched well beyond anything the Founders envisioned. As others have pointed out, patenting business processes and genetic codes found in nature is not what they had in mind.

Nor is granting copyright beyond any reasonable definition of “a limited time.” As one example, Mickey Mouse is coming up on his 100th birthday. His creators are long dead. Yet the image is still protected by copyright.


12 posted on 10/26/2011 7:55:49 AM PDT by Sherman Logan
[ Post Reply | Private Reply | To 4 | View Replies]

To: allmendream
Hardcore socialists believe intellectual property, like physical personal property - should be abolished.

I disagree. Hard-core socialists would believe that all intellectual property belongs to the state. There are,though, many hard-core capitalists who agree with the author of this article.

I haven't made up my mind on the matter yet, but the abuse of patents is obvious. We see, now, situations in which companies are patenting common programming algorithms. And it is true that new companies with an offshoot of an existing idea are often crippled with expenses by an existing patent-holder.

Abolishing intellectual property rights would be a radical move, but it is one that is not without some merit. And, besides, I'd love to stick it to Hollywood :)

13 posted on 10/26/2011 7:57:32 AM PDT by BfloGuy (Even the opponents of Socialism are dominated by socialist ideas.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: ShadowAce

The reason western civilization has flourished is because people believed that if they worked hard and came up with an idea and brought it to fruition that they would actually get paid for the effort by appreciative customers. Otherwise, why bother.

Patent law is what creates that environment. Don’t get me wrong, like unions, it can be over-applied, but it has a real function and is very valuable in ensuring people are incented to innovate.


14 posted on 10/26/2011 7:59:44 AM PDT by cuban leaf (Were doomed! Details at eleven.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Sherman Logan

“Yet the image is still protected by copyright.”

So? That image is someone else’s property. At what point should any property become public domain? After 5 years can I simply move into your house?


15 posted on 10/26/2011 8:00:28 AM PDT by CodeToad (Islam needs to be banned in the US and treated as a criminal enterprise.)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Andy from Chapel Hill

Never thought of a patent that way, I like it. This is an interesting thread. The author makes a mistake cayong All Patents are theft. Patenting improvement to a mechanical device,a computer program, a drug, and a gene are all such different things that it is incredibly complex to try to apply patent law to them. Not impossible, just difficult.


16 posted on 10/26/2011 8:02:43 AM PDT by ngat
[ Post Reply | Private Reply | To 10 | View Replies]

To: ShadowAce

another whiner article to attack success

I own 1 patent, a second is pendin and my 3td is on the drawin board


17 posted on 10/26/2011 8:04:05 AM PDT by advertising guy (dammit)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Sherman Logan
What reasonable economic use would anyone but Disney company have for the image and voice of Mickey Mouse?

While I may agree that patents for limited time for innovations and technologies can somewhat impede the progress of useful arts, technology, and science (not as much as it assists it in my opinion) I refuse to accept that another company should be free to use the licensed trademarks of another company - even after 100 years.

The estates of many an author protect the characters and places the author created from economic exploitation without regard to the intent or long term viability of the character.

If anyone, not just D.C. comics, could make a “Batman” movie - do you think the numerous cashing in projects would not have muddied the water and made it worth much less for the people who created the character?

Copy-write is a different issue - it only impedes the progress of cash in artists looking to be a parasite upon a profitable image or character someone else created.

Sorry to see such little respect for intellectual property on this forum!

18 posted on 10/26/2011 8:05:18 AM PDT by allmendream (Tea Party did not send the GOP to D.C. to negotiate the terms of our surrender to socialism.)
[ Post Reply | Private Reply | To 12 | View Replies]

To: ShadowAce

Pure rubbish.


19 posted on 10/26/2011 8:06:45 AM PDT by Psycho_Bunny (Public employee unions are the barbarian hordes of our time.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ShadowAce

picasso is a bad example to illustrate this point.

after he’d worked with braque, mingling ideas, and

borrowed from miro, his fellow countryman;

he disparged other artists, especially miro, to dealers

for the purpose of advancing his, picasso’s, sales

and thwarting their sales.


20 posted on 10/26/2011 8:08:00 AM PDT by ken21
[ Post Reply | Private Reply | To 1 | View Replies]

To: advertising guy

How much did you have to pay to get the patent? I have one in the works and need to apply for another.


21 posted on 10/26/2011 8:11:43 AM PDT by The Mayor ("If you can't make them see the light, let them feel the heat" — Ronald Reagan)
[ Post Reply | Private Reply | To 17 | View Replies]

To: ShadowAce

Are trade secrets theft? Is the Coke formula or the “Eleven different herbs and spices” theft? How do they differ in this regard from patents?


22 posted on 10/26/2011 8:12:50 AM PDT by muir_redwoods (Somewhere in Kenya, a village is missing an idiot)
[ Post Reply | Private Reply | To 1 | View Replies]

To: allmendream

You are confusing copyright and trademark.

MM is of course protected by both at present.

A trademark is in perpetuity as long as it is actively in use.

A copyright was intended to be for “a limited time.” I seriously doubt the Founders intended that to mean for the life of the author plus 70 years.

You have a perfect right to argue that copyright SHOULD be for a very long time as at present. I don’t think you can logically argue that this is what the Founders intended.


23 posted on 10/26/2011 8:14:10 AM PDT by Sherman Logan
[ Post Reply | Private Reply | To 18 | View Replies]

To: allmendream; Sherman Logan
What reasonable economic use would anyone but Disney company have for the image and voice of Mickey Mouse?

Plus, it's not like there's just a single 100-year-old work being protected. Mickey Mouse has been in constant use over a variety of different works over that whole period. granted, it's more of a trademark than a copyright, but since Disney still actively uses it, there's no reason to allow others to try and make a profit off of Disney's past and present work.

24 posted on 10/26/2011 8:14:34 AM PDT by kevkrom (This space for rent.)
[ Post Reply | Private Reply | To 18 | View Replies]

To: The Mayor

here in Phoenix, I use attorneys who only process patents copyrights etc

my 1st cost 5k to the patent office and 175 bucks per rendering and the lawyers charged a lil over 3 k

I was in my 1st for near 9 k


25 posted on 10/26/2011 8:15:04 AM PDT by advertising guy (dammit)
[ Post Reply | Private Reply | To 21 | View Replies]

To: Pessimist
I've written a few device drivers for linux in my time. And I sure ain't no European.

And if you want documentation, as they say.... "Use the Source, Luke". ;)

/johnny

26 posted on 10/26/2011 8:15:14 AM PDT by JRandomFreeper (gone Galt)
[ Post Reply | Private Reply | To 7 | View Replies]

To: allmendream
What reasonable economic use would anyone but Disney company have for the image and voice of Mickey Mouse?

Walt Disney has been dead for 45 years?

But his copyrights are supposed to live on in-perpetuity for his corporation?

Corporations never die.

It's impossible for individuals to compete with corporations with in-perpetuity anything.

27 posted on 10/26/2011 8:16:09 AM PDT by E. Pluribus Unum ("Government does not solve problems; it subsidizes them." --Ronald Reagan)
[ Post Reply | Private Reply | To 18 | View Replies]

To: ShadowAce

Patents are not theft. However they can be misused or grated incorrectly.

Biological organisms should not be patented.

Software should not be patented. However code should be protected by copyright, but a shorter copyright than that used for books, films, etc.


28 posted on 10/26/2011 8:21:17 AM PDT by GreenLanternCorps ("Barack Obama" is Swahili for "Jimmy Carter".)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Sherman Logan
I was attempting to differentiate between patents on innovations and copywrites on images and characters.

While limiting the use of innovations can be said to be an impediment to progress, I don't see how a similar argument can be made for the exploitation of an image or character someone else created - I don't see that as progress.

Patents for innovations are for 20 years. Copyright on stories, places, characters and images created by an author are for the life of the author plus 70 years - that is PERFECTLY reasonable in my opinion.

In the time of the founders the timeframe was 14 years for useful technologies and such - I don't think 20 years is significantly different than 14 as to making an argument that 14 years is in line with what the founders intended but 20 is far beyond what they intended. So I CAN logically make the argument that 20 years is well in line with what the founders intended, because 14 is what they granted in 1790.

29 posted on 10/26/2011 8:23:52 AM PDT by allmendream (Tea Party did not send the GOP to D.C. to negotiate the terms of our surrender to socialism.)
[ Post Reply | Private Reply | To 23 | View Replies]

To: E. Pluribus Unum

The best way to handle that would be an absolute maximum on copyrights.

Life of the creator, plus 50 years. Or 100 years from date of public release.


30 posted on 10/26/2011 8:28:06 AM PDT by GreenLanternCorps ("Barack Obama" is Swahili for "Jimmy Carter".)
[ Post Reply | Private Reply | To 27 | View Replies]

To: E. Pluribus Unum
Yes, Disney company should have the freedom to work on and develop the characters and images Disney created free from ‘cash in’ artists seeking to parasitize their property.

It is quite possible for individuals to compete with corporations with established characters and images without using their characters and images - they just have to invent NEW characters and images.

I know that might be hard, it just isn't FAIR that uncreative people cannot exploit and profit off the characters and images created by creative people!/s

31 posted on 10/26/2011 8:28:06 AM PDT by allmendream (Tea Party did not send the GOP to D.C. to negotiate the terms of our surrender to socialism.)
[ Post Reply | Private Reply | To 27 | View Replies]

To: ShadowAce

What’s even worse ave patents for software that make it impossible to create an app if some yahoo patented a bunch of little things that are necessary for the concept to even work!


32 posted on 10/26/2011 8:28:20 AM PDT by VanDeKoik (1 million in stimulus dollars paid for this tagline!)
[ Post Reply | Private Reply | To 8 | View Replies]

To: muir_redwoods
Trade secrets are just that--secret. If Coke applied for a patent on its formula, then the formula would be public.

As long as Coke keeps its formula secret, and no one else is able to copy it, then they're good.

But that is a risk.

33 posted on 10/26/2011 8:28:44 AM PDT by ShadowAce (Linux -- The Ultimate Windows Service Pack)
[ Post Reply | Private Reply | To 22 | View Replies]

To: ShadowAce; SunkenCiv; neverdem; decimon

“Patents are its delinquent offspring, providing stumbling blocks to innovation and progress, inhibiting the free exchange of ideas, and restricting our knowledge of how things work.”

Actually it is the opposite, by submitting a patent you have to describe your invention thus disseminating your idea and increasing the corpus of knowledge.

Assume that you are working on a product that will cost say 1 M USD to show that it works and the time for this is say 3 years. The probability that it will work is 10 %.

Then you have to test it on humans as it is a pharmaceutical drug and then you have to check for side effects, the risk for this is say 90 %. Now you have worked with the product for 7 years, but it is still too early to bring in to the market. This will cost > 100 MUSD. And you now have 7 - 10 years for the product on the market if it suceeds.

It is not uncommon that a drug late in the development has to be scrapped due to side effects.

If there was no patent a chemist can copy the drug and sell it without the cost for development. If patents are abolished the development will stop, except for products with short Time-to-Market cycles.


34 posted on 10/26/2011 8:32:00 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: advertising guy

Wow! Something I have to do but the cost is outrageous.


35 posted on 10/26/2011 8:32:59 AM PDT by The Mayor ("If you can't make them see the light, let them feel the heat" — Ronald Reagan)
[ Post Reply | Private Reply | To 25 | View Replies]

To: allmendream
Evidently you believe that patents and copyrights were established for the benefit of corporations.

You do realize that the original intent of the founders was to provide income to the actual creator during his lifetime, right?

To you the Constitution is a "living document" that should conform to your whims.

36 posted on 10/26/2011 8:33:22 AM PDT by E. Pluribus Unum ("Government does not solve problems; it subsidizes them." --Ronald Reagan)
[ Post Reply | Private Reply | To 31 | View Replies]

To: BfloGuy
Abolishing intellectual property rights would be a radical move, but it is one that is not without some merit. And, besides, I'd love to stick it to Hollywood :)

Make it like patents, 20 years then it is public domain. Guys who can crank out a blockbuster every two years won't notice. Guys like Lucas who had one good idea back in 1977 and is still milking it would be in a world of hurt.
37 posted on 10/26/2011 8:38:41 AM PDT by GonzoGOP (There are millions of paranoid people in the world and they are all out to get me.)
[ Post Reply | Private Reply | To 13 | View Replies]

To: E. Pluribus Unum

Evidently I believe that patents and copyrights were established by our founders to promote the useful arts and sciences. That was the intent of our founders - and yes the effect would be the provide income to the creator, his estate, and/or his corporation.

Do you think “corporation” is a bad bad word that should invoke revulsion and derision in all good men?

The Constitution is a document of words with set and definite meaning. The meaning of the Constitution in regards to patent and copyright law is clear - and it is clearly in line with my own view.

Socialism where all property, physical or intellectual - belongs to ‘the people’ (i.e. the State), and where “corporations” and “profit” are bad bad things seems to be the credo your delusions are more in line with.


38 posted on 10/26/2011 8:39:29 AM PDT by allmendream (Tea Party did not send the GOP to D.C. to negotiate the terms of our surrender to socialism.)
[ Post Reply | Private Reply | To 36 | View Replies]

To: ShadowAce
Linux and the "free" software crowd copied virtually everything and invented next to nothing. Granted they wrote the software from scratch but they cloned Unix. It's not a bad thing but their ideas on invention are skewed from the beginning.

As an example, if I write a clone of Tetris without access or use of any of the original source, I didn't actually invent anything.

39 posted on 10/26/2011 8:45:30 AM PDT by douginthearmy
[ Post Reply | Private Reply | To 1 | View Replies]

To: ShadowAce

You could always approach this the way Fishware did when it was providing software for the Amiga and other systems.....charge a low price and patent nothing. No one forces you to apply for a patent. Some companies over apply with too much blue sky but the Patent Office in many ways is to quick to grant patents...and as with any good bureaucracy sometimes it is way to slow.


40 posted on 10/26/2011 8:50:34 AM PDT by Nifster
[ Post Reply | Private Reply | To 1 | View Replies]

To: E. Pluribus Unum
I agree patents on genetic sequences, and especially those that already exist in nature, are wrong. But that is a failure of the patent examiner - patents are not supposed to be granted for prior art, and existing natural genetic sequences would be just that.

Likewise, a lot of the failings with IT sector patents are granted for failure to recognize prior art.

41 posted on 10/26/2011 8:53:08 AM PDT by dirtboy
[ Post Reply | Private Reply | To 6 | View Replies]

To: douginthearmy
Linux is not Unix.

It is POSIX-compliant. Much different, though it makes the two systems look similar.

42 posted on 10/26/2011 8:55:34 AM PDT by ShadowAce (Linux -- The Ultimate Windows Service Pack)
[ Post Reply | Private Reply | To 39 | View Replies]

To: ShadowAce

I don’t think patents are necessarily theft (though they can be). I just think they are pretty much unenforceable anymore unless you are a huge corporation. Building your business model solely on the hope of enforcing your patent is pretty risky.


43 posted on 10/26/2011 8:59:21 AM PDT by DaxtonBrown (http://www.futurnamics.com/reid.php)
[ Post Reply | Private Reply | To 1 | View Replies]

To: advertising guy

How did you manage to pay $5K to the Patent Office?


44 posted on 10/26/2011 9:02:17 AM PDT by BwanaNdege (“Man has often lost his way, but modern man has lost his address” - Gilbert K. Chesterton)
[ Post Reply | Private Reply | To 25 | View Replies]

To: ShadowAce

Well understood but my point was if patents are theft what “crime” is it to intentionally deprive the world of ones discovery/development by keeping it a secret?


45 posted on 10/26/2011 9:05:15 AM PDT by muir_redwoods (Somewhere in Kenya, a village is missing an idiot)
[ Post Reply | Private Reply | To 33 | View Replies]

To: muir_redwoods

Ahh—gotcha. I totally misunderstood your post, then.


46 posted on 10/26/2011 9:09:11 AM PDT by ShadowAce (Linux -- The Ultimate Windows Service Pack)
[ Post Reply | Private Reply | To 45 | View Replies]

To: BwanaNdege

I didn;t the patent attorney did


47 posted on 10/26/2011 9:20:41 AM PDT by advertising guy (dammit)
[ Post Reply | Private Reply | To 44 | View Replies]

To: The Mayor
"http://www.nolo.com/products/patent-it-yourself-PAT.html"

Affordable, comprehensive and highly recommended book.

A "Preliminary Patent Application" gets you one year of "Patent Pending " protection an cost $75 last time I checked. Initial filing fee was about $750.

A patent attorney will charge you an bundle. You can either do your own online patent search, or hire a professional searcher for far less thatnthe attorney will charge you for the searchers fee.

Lots of "Patent it Yourself" software out there also.

48 posted on 10/26/2011 9:23:19 AM PDT by BwanaNdege (“Man has often lost his way, but modern man has lost his address” - Gilbert K. Chesterton)
[ Post Reply | Private Reply | To 35 | View Replies]

To: BwanaNdege

the claims are the broad strokes of intellectual property

doin my own patent is like removing my own appendix myself

no chance


49 posted on 10/26/2011 9:30:16 AM PDT by advertising guy (dammit)
[ Post Reply | Private Reply | To 48 | View Replies]

To: advertising guy

“I didn’t the patent attorney did”

Here is the Fee Schedule, in case you want to check your attorney’s itemized bill to you.

http://www.uspto.gov/web/offices/ac/qs/ope/fee092611.htm


50 posted on 10/26/2011 9:33:00 AM PDT by BwanaNdege (“Man has often lost his way, but modern man has lost his address” - Gilbert K. Chesterton)
[ Post Reply | Private Reply | To 47 | View Replies]


Navigation: use the links below to view more comments.
first 1-5051-68 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson