Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Parasite of the Day -- Paragordius obamai
Parasite of the Day ^ | April 19, 2012 | Susan Perkins

Posted on 04/25/2012 5:42:41 PM PDT by SunkenCiv

Sex is one of the great mysteries of evolutionary biology -- why do organisms have it? It has numerous costs associated with it, including the two big ones, which are that only half the population will produce offspring in the next generation (technically really a problem more of anisogamy than sex, per se) and that successful gene combinations can be broken up via recombination. There are other costs as well. For instance, finding and wooing mates can be costly to an organism.

Nematomorphs, sometimes called hairworms, are parasites that live inside arthropods as larvae, but then exist as free-living aquatic adults. They often induce suicide in their insect hosts, by causing them to jump into water, where the worms then escape (see this previous post for another example). The adults typically seek out the opposite sex and can form "Gordian knots" of mating worms. Today's species, however, is found in larger and faster-moving waters -- and in these big, complicated habitats, finding a suitable mate can be really tricky. So, today's parasite, has solved this problem through the evolution of parthenogenesis. Meet Paragordius obamai, (named after President Obama, in honor of it being discovered in Kenya, where his father was raised), a species of nematomorph that has completely given up on males. When brought into the lab, P. obamai only released female worms and nowhere inside these stringy parasites could male reproductive organs be found. Because bacterial symbionts can sometimes produce severe sex-ratio biases or even male-killing in insects and other invertebrates, the authors used pyrosequencing to look for evidence of these micro-manipulators, yet found no sequences similar to the taxa that have been observed to cause these biases in other hosts.

(Excerpt) Read more at dailyparasite.blogspot.se ...


TOPICS: Science
KEYWORDS: paragordiusobamai; parasite; parasites; science
Paragordius obamai

Paragordius obamai

1 posted on 04/25/2012 5:42:51 PM PDT by SunkenCiv
[ Post Reply | Private Reply | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; ColdOne; Convert from ECUSA; ...

Thanks AdmSmith.


2 posted on 04/25/2012 5:44:09 PM PDT by SunkenCiv (FReepathon 2Q time -- https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

Ironic that a species named after the occupier of the White House would have given up on males...


3 posted on 04/25/2012 5:47:27 PM PDT by null and void (Day 1191 of America's ObamaVacation from reality [Heroes aren't made Frank, they're cornered...])
[ Post Reply | Private Reply | To 1 | View Replies]

Alfonso Bedoya

No, there is no
"Parasite of the Day" ping list.
So don't write in, okay? :'D


4 posted on 04/25/2012 5:49:41 PM PDT by SunkenCiv (FReepathon 2Q time -- https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | View Replies]

To: null and void

That was probably part of the cybernetic cranial implantation.


5 posted on 04/25/2012 5:53:12 PM PDT by SunkenCiv (FReepathon 2Q time -- https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | To 3 | View Replies]

To: SunkenCiv

“... no parasite of the day ping list...”

You educate us about this parasite and then decide that you won’t have a ping list?!! You are such a tease, SunkenCiv!


6 posted on 04/25/2012 5:54:41 PM PDT by momtothree
[ Post Reply | Private Reply | To 4 | View Replies]

To: null and void

It is kind of perfect that the species named after Obama is a parasite :)


7 posted on 04/25/2012 6:04:43 PM PDT by Boogieman
[ Post Reply | Private Reply | To 3 | View Replies]

To: momtothree

If we worm meant to have a parasite list, someone would have started it by now. I guess it will, for now, remain an itch we can’t quite scratch.


8 posted on 04/25/2012 6:34:37 PM PDT by SunkenCiv (FReepathon 2Q time -- https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | To 6 | View Replies]

To: SunkenCiv
I don't think I have ever encountered the word "anisogamy" before, let alone seen it used in a sentence.

I have nothing against anise, and have even eaten some, many years ago, but I wouldn't want to marry it.

9 posted on 04/25/2012 7:06:56 PM PDT by Verginius Rufus
[ Post Reply | Private Reply | To 1 | View Replies]

To: Verginius Rufus

LOL!


10 posted on 04/25/2012 7:55:34 PM PDT by SunkenCiv (FReepathon 2Q time -- https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | To 9 | View Replies]

To: momtothree; SunkenCiv
You are such a tease, SunkenCiv!

Yeah, nuthin' but a cheap click tease...

Cheers!

11 posted on 04/25/2012 10:18:03 PM PDT by grey_whiskers (The opinions are solely those of the author and are subject to change without notice.)
[ Post Reply | Private Reply | To 6 | View Replies]

To: SunkenCiv

A story about the discovery of the hairworm is here http://www.nematomorpha.net/Paragordius_obamai.html

There is as well a http://en.wikipedia.org/wiki/Leafhopper named after him: http://species.wikimedia.org/wiki/Osbornellus_obamai


12 posted on 04/26/2012 1:38:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson