Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Why The Russians Are Panicking Over Flight 17
The Federalist ^ | July 21, 2014 | Tom Nichols

Posted on 07/22/2014 4:41:54 AM PDT by right-wing agnostic

The one emotion most of us who study Russia never associate with the men of the Kremlin is panic. They’re not the type. They’re more like mobsters, prone to say “we have a problem” rather than to freak out. They think everything has a solution, although sometimes that solution might mean someone has to take nine grams of lead behind the ear. They do not raise their voices—my experience is that most Russian tough-guys are mumblers, not yellers—and they get things done, even if the final outcome might lack a certain, say, elegance.

That’s why it’s unusual to see the government of Vladimir Putin, and maybe even Putin himself, panicking over the downing of Malaysian Airline Flight 17. For the first time in a long time, maybe even since Putin’s first election to power, the Russian regime has a problem it cannot solve, one that will cost the Kremlin in both money and reputation.

(Excerpt) Read more at thefederalist.com ...


TOPICS: Miscellaneous
KEYWORDS: duplicate; russia; search; terrorism; vladimirputin
I hope the author is right about this. At the very least I hope we impose harsher sanctions on Russia that will have a negative effect on their economy. And WE MUST start exporting natural gas to help Ukraine through this very difficult situation. I hope this opens the Europeans' eyes to the danger Vladimir Putin poses to the West and will help imposes further sanctions against Russia. With the Marxist-in-Chief in the Oval Office, I fear we will once again turn our backs on our allies and embolden our enemies. I'm not at all optimistic that this will be the case, but hope springs eternal./rwa
1 posted on 07/22/2014 4:41:55 AM PDT by right-wing agnostic
[ Post Reply | Private Reply | View Replies]

To: right-wing agnostic

In 1988 the USS Vincennes, a guided missile cruiser, entered Iranian territorial waters and spotted an aircraft that it thought was an Iranian F-14 fighter plane. However, it was actually a civilian Iran Air Airbus A300, flying over Iran’s territorial waters on its regular route from Tehran to Dubai in the United Arab Emirates. The Vincennes fired a surface-to-air missile that destroyed the plane, killing all 290 onboard. Under a 1996 agreement at the International Court of Justice, the U.S. agreed to pay Iran $61.8 million.

Have Russia pay a fine of $61.8 million. Problem solved.


2 posted on 07/22/2014 4:44:12 AM PDT by satan (The tree of liberty is dying in the drought.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: right-wing agnostic

They all think like Stalin:

“The death of one man is a tragedy. The death of many is a statistic.”


3 posted on 07/22/2014 4:45:12 AM PDT by SMARTY ("When you blame others, you give up your power to change." Robert Anthony)
[ Post Reply | Private Reply | To 1 | View Replies]

To: satan

“Have Russia pay a fine of $61.8 million. Problem solved.”

With http://www.usinflationcalculator.com/ that would be $94 today


4 posted on 07/22/2014 4:50:08 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: right-wing agnostic

Vlad: First, send the black box to Lois Lerner. Announce you heard about it by reading it in the papers.

Next, announce a full-scale investigation, and now that it’s under way, you cannot comment. Go on a two week vacation.


5 posted on 07/22/2014 4:51:34 AM PDT by wayoverontheright
[ Post Reply | Private Reply | To 1 | View Replies]

To: right-wing agnostic

The Russians aren’t panicking, they’re just waiting for the West to come down from their tantrum. At worst it was an accident caused by a combination of giving the weapons to the wrong people, and then IDIOTS allowing airliners to fly over an ACTIVE WAR ZONE with planes being shot down. Neither the Russians, nor the rebels, had ANYTHING TO GAIN by shooting down a planeload of innocent people, and people are coming to see that.


6 posted on 07/22/2014 4:58:42 AM PDT by BobL
[ Post Reply | Private Reply | To 1 | View Replies]

To: wayoverontheright; All
or give the offending "black box" a trip to Fort Marcy Park in
Wash. D.C. and a armed explosive satchel rigged to blow @ 4am.

7 posted on 07/22/2014 5:00:55 AM PDT by skinkinthegrass (The end move in politics is always to pick up a weapon...0'Bathhouse/"Rustler" Reid? d8-)
[ Post Reply | Private Reply | To 5 | View Replies]

To: satan

wrong

on so many levels

have you been reading your history on Huffington Post?


8 posted on 07/22/2014 5:06:25 AM PDT by silverleaf (Age takes a toll: Please have exact change)
[ Post Reply | Private Reply | To 2 | View Replies]

To: BobL

So, we’re just supposed to ignore the intercepted phonecall from the intel commander to his deputy, right?

Really?


9 posted on 07/22/2014 5:10:36 AM PDT by sauropod (Fat Bottomed Girl: "What difference, at this point, does it make?")
[ Post Reply | Private Reply | To 6 | View Replies]

To: BobL

I don’t think anyone is tuoting the line that the Russians or anyone else intentionally shot down a civilian airliner. What is said is that this was a weapon system that never ought to have been entrusted to such irresponsible people.

It is like handing a loaded AK47 to an excited chimpanzee and expecting the chimp to behave responsibly. The Russians should never have entrusted these jokers with anything like the BUK system.

That’s the point, not that the Russians thought it would be a great idea to shoot down an international passenger aircraft.


10 posted on 07/22/2014 5:11:58 AM PDT by John Valentine (Deep in the Heart of Texas)
[ Post Reply | Private Reply | To 6 | View Replies]

To: BobL

Exactly so.


11 posted on 07/22/2014 5:20:18 AM PDT by Bobalu (Israel is the most long-suffering and peace loving nation on Earth.)
[ Post Reply | Private Reply | To 6 | View Replies]

To: right-wing agnostic

Sometimes even mobsters have panic attacks.

see: Tony Soprano


12 posted on 07/22/2014 5:21:32 AM PDT by Buckeye McFrog
[ Post Reply | Private Reply | To 1 | View Replies]

To: John Valentine

“What is said is that this was a weapon system that never ought to have been entrusted to such irresponsible people.”

Like giving ANY weapons to those ISIS savages in Syria that are butchering hundreds of people each month thanks to the United States?

We have no moral authority to condemn Russia for anything.


13 posted on 07/22/2014 5:26:01 AM PDT by Azeem (There are four boxes to be used in the defense of liberty: soap, ballot, jury and ammo.)
[ Post Reply | Private Reply | To 10 | View Replies]

To: BobL

“Neither the Russians, nor the rebels, had ANYTHING TO GAIN by shooting down a planeload of innocent people, and people are coming to see that.”

100% correct. I do not believe for a moment Russia or Putin gave orders to shoot that plane down whatsoever. What I DO know is “evidence” I’ve seen is bogus. For one, the supposed photo or the BUK’s vapor trail was taken on a CLEAR DAY. Yet the footage shown around the world (minutes later) of the downed plane burning and it’s smoke rising is a VERY CLOUDY DAY. Hmmmm...???? My guess is Ukraine is trying to make Russia look bad/put it on them purposefully because they got no satisfaction after losing Crimea.


14 posted on 07/22/2014 5:28:05 AM PDT by sevinufnine (A moderately bad man knows he is not very good. A thoroughly bad man thinks he's alright. C.S. Lewis)
[ Post Reply | Private Reply | To 6 | View Replies]

To: right-wing agnostic

Why Starbucks is panicking over caramel lattes.

Why ranchers are panicking over red cedar.

Why brewers are panicking over yeast.

Man, anyone can write headlines like this.


15 posted on 07/22/2014 5:28:25 AM PDT by MrEdd (Heck? Geewhiz Cripes, thats the place where people who don't believe in Gosh think they aint going.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

The Kremlin ‘Specialist for Creating New Independent States’ Moves to Eastern Ukraine

Publication: Eurasia Daily Monitor Volume: 11 Issue: 132

http://www.jamestown.org/single/?tx_ttnews%5Btt_news%5D=42650


16 posted on 07/22/2014 5:31:51 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4 | View Replies]

To: sauropod

“So, we’re just supposed to ignore the intercepted phonecall from the intel commander to his deputy, right?”

If they are bragging about shooting down an innocent civilian plane, then no. However, I don’t think that was the case.


17 posted on 07/22/2014 5:37:22 AM PDT by BobL
[ Post Reply | Private Reply | To 9 | View Replies]

To: John Valentine

“What is said is that this was a weapon system that never ought to have been entrusted to such irresponsible people.”

I’m not sure that giving the Taliban, ISIS, or Libyan rebels Manpads is such a hot idea either, as they only have to get them into Jamaica Bay and they can be shooting down planes landing and taking off at JFK.

We’re not exactly squeaky-clean ourselves - we’re just fortunate that nothing has happened (yet).


18 posted on 07/22/2014 5:40:45 AM PDT by BobL
[ Post Reply | Private Reply | To 10 | View Replies]

To: BobL
Neither the Russians, nor the rebels, had ANYTHING TO GAIN by shooting down a planeload of innocent people, and people are coming to see that.

I don't think people are suggesting that they deliberately targeted MH17. It was a colossal screw-up but responsibility for it still lies somewhere. And the overwhelming majority of the evidence points to the sepratists and their Russian masters. I tend to agree with you that Russia can ride this one out but at a cost. And the cost may well be eastern Ukraine. Putin will probably have to end his support for them.

19 posted on 07/22/2014 5:44:36 AM PDT by DoodleDawg
[ Post Reply | Private Reply | To 6 | View Replies]

To: right-wing agnostic

You guys are watching too much Fox News. No matter how horrible you think Putin is...he loves to be loved. His priorities seem to be that he is always trying to gain more and more popularity. It’s seems like a fetish of some sort. Yes he would most definitely put bullet in your head behing closed doors,,,,but no way in hell would he EVER order a civilian plane to be shot out the sky knowing it might damage his precious popularity rating.


20 posted on 07/22/2014 5:53:41 AM PDT by rwoodward ("god, guns and more ammo")
[ Post Reply | Private Reply | To 1 | View Replies]

To: satan
A quick question on your moral equivalency:

If a bank robber accidentally kills a teller, while shooting at the police, is that the same thing as a policeman who accidentally shoots a teller, while shooting at a bank robber?

I tend to think the underlying motivations matter, and I blame the bank robber for the teller's death in both scenarios.

21 posted on 07/22/2014 6:12:27 AM PDT by SampleMan (Feral Humans are the refuse of socialism.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: BobL

“... we’re just fortunate that nothing has happened (yet).”

Fortunate beyond belief.

No gambler in the history of the world has ever had this kind of good fortune. With this country’s lackadaisical leadership, our open borders, and an organized criminal element importing Lord knows what, I’m surprised Washington hasn’t been replaced with a mushroom cloud.

I’m guessing that right now, in the U.S., there are manpads hidden in closets and garages. Mohammed and Azim are just waiting for the “word” to pull these toys out. Airplanes will then begin falling out of the sky


22 posted on 07/22/2014 6:14:22 AM PDT by moovova
[ Post Reply | Private Reply | To 18 | View Replies]

To: sauropod
So, we’re just supposed to ignore the intercepted phonecall from the intel commander to his deputy, right?

How about releasing the transcripts from air traffic control tower which were seized by Ukraine Secuity Services and the USA satellite photos of the conflict zone from July 18th?

IOW stop pussyfooting around with the easily disputed social media stuff and produce some real evidence for a change.

23 posted on 07/22/2014 6:27:37 AM PDT by mac_truck ( Aide toi et dieu t aidera)
[ Post Reply | Private Reply | To 9 | View Replies]

To: silverleaf

Where is the poster substantially wrong? Educate me here.

Bandar Abbas, not Tehran to Dubai. Two missiles, not one. The Airbus was climbing out, on a vector toward the ship from land, while the ship was in Iranian waters chasing gunboats. That would logically indicate to me that the plane was in Iranian airspace.

The US agreed to pay 61.8 million to the victims and about 70 million more (for the plane?).

The shoot-down was a horrible mistake, an action undertaken in circumstances that are pretty hard to defend based on the data.


24 posted on 07/22/2014 6:32:36 AM PDT by SargeK
[ Post Reply | Private Reply | To 8 | View Replies]

To: BobL

Nice try. All the blame belongs to the Russians and their sock puppets.
THEY fired a missile that killed nearly 300 people. The rest of us have a expectation that Barbarians won’t attack innocent civilians.


25 posted on 07/22/2014 6:36:47 AM PDT by Kozak ("It may be dangerous to be America's enemy, but to be America's friend is fatal" Henry Kissinger)
[ Post Reply | Private Reply | To 6 | View Replies]

To: Azeem

“We have no moral authority to condemn Russia for anything.”

Complete nonsense - or worse.


26 posted on 07/22/2014 10:55:54 AM PDT by John Valentine (Deep in the Heart of Texas)
[ Post Reply | Private Reply | To 13 | View Replies]

To: sevinufnine

“For one, the supposed photo or the BUK’s vapor trail was taken on a CLEAR DAY.”

No such video - I challenge you to provide a link.


27 posted on 07/22/2014 11:00:32 AM PDT by John Valentine (Deep in the Heart of Texas)
[ Post Reply | Private Reply | To 14 | View Replies]

To: John Valentine

“Complete nonsense - or worse.”

We are arming the most evil people on the planet (Muslim Brotherhood, Libya, ISIS) who kill more civilians intentionally (especially Christian women and children) each month than were on that plane.


28 posted on 07/22/2014 11:58:16 AM PDT by Azeem (There are four boxes to be used in the defense of liberty: soap, ballot, jury and ammo.)
[ Post Reply | Private Reply | To 26 | View Replies]

To: Azeem

Here’s the thing - even if I agree with you re. ISIS etc., that sad fact does not render us deaf dumb and blind.


29 posted on 07/22/2014 2:11:57 PM PDT by John Valentine (Deep in the Heart of Texas)
[ Post Reply | Private Reply | To 28 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson