Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

'Sub Attack Came Near Drill'
Military.com ^ | 6/5/2010 | Associated Press via Military.com

Posted on 06/06/2010 1:01:43 AM PDT by ErnstStavroBlofeld

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-31 last
To: chuck_the_tv_out

“awaiting United Nations action” good luck with that ....................................... The UN needs time, they are looking for the proper PC wording for their really strong letter of reprimand. PRK will really get it this time, no more nice guys, this letter will be stronger than the last 100 or so. LOL


21 posted on 06/06/2010 9:20:57 AM PDT by Bringbackthedraft (THE CANDIDATE THE LEFT SMEARS THE MOST IS THE ONE THEY FEAR THE MOST.)
[ Post Reply | Private Reply | To 7 | View Replies]

To: Bringbackthedraft

The entire NK navy should be sunk at the pier.


22 posted on 06/06/2010 10:11:30 AM PDT by littleharbour
[ Post Reply | Private Reply | To 21 | View Replies]

To: TigerLikesRooster

Speaking of tin foil Alex Jones believes that is was an Israeli sub that came half way around the world in order to sink the South Korean ship.


23 posted on 06/06/2010 10:19:01 AM PDT by artichokegrower
[ Post Reply | Private Reply | To 3 | View Replies]

To: sonofstrangelove

It is no longer possible to believe that, in this event and many other recent events, that everything is as it seems.

We will only see the “evidence” that they want us to see, be it real or fabricated.


24 posted on 06/06/2010 11:26:47 AM PDT by granite (A government big enough to give you everything you want is strong enough to take everything you have)
[ Post Reply | Private Reply | To 1 | View Replies]

To: sonofstrangelove; TigerLikesRooster; gandalftb
North Korean Yeoneo class attack sub (according to Planeman)


http://planeman-bluffersguide.blogspot.com/2010/06/north-korean-yeoneo-class-attack-sub.html

25 posted on 06/07/2010 2:22:12 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

From http://planeman-bluffersguide.blogspot.com/2010/06/north-korean-yeoneo-class-attack-sub.html,... "Another lead provided by Lee is that some Cubans have inspected North Korean submarines and may have purchased some. This ties with the 'mystery' Cuban midget submarine photographed in Havana and previously included in Fortress Cuba"

Although I believe unfounded, those tin foil allusions to the BP Oil Leak having been the result of an attack by others have more circumstantial support. Just to allay concerns, unless it can be shown the oil rig were destroyed by forces within 200 ft of the surface, I don't think these types of subs would be associated with oil well failures some 5000 ft deep.

26 posted on 06/07/2010 2:37:37 AM PDT by Cvengr (Adversity in life and death is inevitable. Thru faith in Christ, stress is optional.)
[ Post Reply | Private Reply | To 25 | View Replies]

To: Cvengr; TigerLikesRooster; AmericanInTokyo
Here is a link from planeman:

http://www.businessinsider.com/map-of-the-day-how-north-korea-could-destroy-seoul-in-two-hours-2010-5

MAP OF THE DAY: How North Korean Artillery Could Level Seoul In Two Hours

Check out the comments!

27 posted on 06/07/2010 4:05:31 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 26 | View Replies]

To: TigerLikesRooster

My that’s some pretty strong hashish in their bongs they are smoking down there in Chongro-gu if they really think that. What a bunch of idiots. That HAD to be manufactured right ouf of the active measures/disinformatizya offices of the KWP in Pyongyang and then spread amongst the leftist elite down in the South. Sheesh!


28 posted on 06/07/2010 4:19:29 AM PDT by AmericanInTokyo (After DPRK collapse opened State Archives may well show Roger Clinton was serviced by NK "honeypots")
[ Post Reply | Private Reply | To 6 | View Replies]

To: AmericanInTokyo
Things are getting creepy. All these college-age dorks are whipped by concerted disinformation campaign. I feel like seeing a full-blown cult in a frenzy. It would also make NK regime misjudge the situation. When this whole thing collapses, it will be big. However, that is the only way, I am afraid. A frenzy passion of cult does not subside orderly. I wonder how these folks take the reality once their illusion is shattered. Whatever psychological damage this does to them, I don't really feel bad about them. Their damage to well-being of S. Korea is incalculable. They deserve whatever shock that is unleashed to them. Youth is not really a mitigating factor, just as it is not when somebody committed a murder. We have some variation of Red Guard frenzy going on here.
29 posted on 06/07/2010 5:58:20 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 28 | View Replies]

To: TigerLikesRooster

A lot of it I take is the education system influenced by Socialist Educators, and in many other cases, just being spoiled rotten as kids, with no sense of history of the Korean Peninsula in perspective, particularly such international crimese as that unleashed upon the South one June morning in 1950. Much as it is here in Japan with brainwashing of a lot of spoiled, ignorant Japanese youth.


30 posted on 06/07/2010 8:39:18 AM PDT by AmericanInTokyo (After DPRK collapse opened State Archives may well show Roger Clinton was serviced by NK "honeypots")
[ Post Reply | Private Reply | To 29 | View Replies]

To: sonofstrangelove
It may well have been a mistake. All NK military units are extremely tightly controlled....for fear of defection. Border units are given little or no ammunition.

There was an SK sub in the area that was used as bait for a joint US/SK anti-sub exercise about 50 miles W and at the time of the Cheonan sinking.

Possible NK subs were there to see if they would be spotted also, testing their stealth in shallow waters. If so, tubes would have been loaded in case the NK sub was attacked. However, the order to fire would have to come from at least two officers in agreement.

My theory is that the NK sub sent a homing tropedo in the general direction of the anti-sub exercises to see what the response would be. The very noisy Cheonan happened along and the torpedo turned and chose it instead.

Frankly, the strangest behavior is by our own Navy. We sent a lone destroyer to the scene at flank speed, followed by a salvage ship. They were both there in less that two hours. Our commanders had to assume a potential hostile event either torpedo or mine. Why would we send a lone destroyer and not sweep the area clear of enemy subs first? In an area known for NK belligerence and unprovoked attacks? And risk another ship to the same fate? Much less an undefended salvage ship?

We had an entire anti-sub exercise underway at the same time, an hours sailing time away and they continued their exercise for another 8 hours before responding. Very odd.

Posted Sunday, June 06, 2010 6:50:26 AM by gandalftb

31 posted on 06/07/2010 2:33:24 PM PDT by gandalftb (OK State: Go Cowboys)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-31 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson