Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Study: Homosexuality Linked with Childhood Trauma
LifeSiteNews.com ^ | July 27, 2010 | By James Tillman

Posted on 07/27/2010 11:25:06 AM PDT by topher

Tuesday July 27, 2010


Study: Homosexuality Linked with Childhood Trauma

By James Tillman

DUNEDIN, New Zealand, July 26, 2010 (LifeSiteNews.com) -- A recent Otago University study has found that homosexual or bisexual individuals are more likely to have undergone a variety of of traumas in childhood, including sexual assault, rape, violence, and witnessing violence in the home.

"People who either identify themselves as homosexual or bisexual, or have had a same-sex encounter or relationship, tend to come from more disturbed backgrounds," said Research Associate Professor Elisabeth Wells.

The study analyzed results from a New Zealand Mental Health study that surveyed about 13,000 people between 2003 and 2004.  98% of the participants in the study identified themselves as heterosexual; 0.8% identified as homosexual; 0.6% identified as bisexual; and 0.3% identified as "something else."

Of people who reported certain traumatic childhood events, 15% were not heterosexual; of those without such experiences, only 5% were not heterosexual, suggesting that such experiences tripled the chance of later professing homosexual or bisexual inclinations.

Some homosexualist leaders took issue with the study's findings: Tony Simpson, chairman of the national homosexualist group Rainbow Wellington, said that the research should not be taken to mean that homosexuals are not born that way. "I have no doubt that the religious right will leap to the conclusion that this goes to show conclusively that homosexuals are made rather than born," he said.

Wells attempted to assuage fears over the study's conclusions.

"I suspect there might be some gay and lesbian people who will be indignant, but it is not my intention to anger them," she said.  "You could say that if someone was sexually abused as a child, chooses to live as a homosexual and lives life well, then that is not a bad thing.  But if they are living a homosexual life and regretting it, that is another matter."

Although sexual or physical abuse in childhood was associated with adult homosexuality, other traumatic experiences, such as the sudden death of a loved one or serious childhood illness or accident, were only slightly associated with non-heterosexual identity or behaviour.

Of females who self-identified as homosexual, more than 40% had been married and had children, whereas 13% of male homosexuals had done so.  Over 80% of those who identified as bisexual were women.

The association between child abuse and later homosexual identification is not young.  

One 1992 study found that 37% of homosexual and bisexual men attending sexually transmitted disease clinics had been encouraged or forced to have sexual contact before age 19 with an older or more powerful partner.  The median age of first contact was 10 years old.

URL: http://www.lifesitenews.com/ldn/2010/jul/10072701.html


Copyright © LifeSiteNews.com. This work is licensed under a Creative Commons Attribution-No Derivatives License. You may republish this article or portions of it without request provided the content is not altered and it is clearly attributed to "LifeSiteNews.com". Any website publishing of complete or large portions of original LifeSiteNews articles MUST additionally include a live link to www.LifeSiteNews.com. The link is not required for excerpts. Republishing of articles on LifeSiteNews.com from other sources as noted is subject to the conditions of those sources.


TOPICS: Australia/New Zealand; Culture/Society; Extended News; Miscellaneous; News/Current Events
KEYWORDS: abuse; homosexual; trauma
Navigation: use the links below to view more comments.
first 1-5051-100101-125 next last
This may be the study that got a California Biology teacher fired -- but it is unclear.

The California teacher won a lawsuit last Thursday.

1 posted on 07/27/2010 11:25:08 AM PDT by topher
[ Post Reply | Private Reply | View Replies]

To: topher

bookmark.


2 posted on 07/27/2010 11:27:57 AM PDT by IrishCatholic (No local Communist or Socialist Party Chapter? Join the Democrats, it's the same thing!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: topher

Good to see this. I wouldn’t call it “news” for those of us who pay attention, but it’s great to make this information available to help show that homosexuality is really a mental illness.


3 posted on 07/27/2010 11:28:04 AM PDT by ClearCase_guy
[ Post Reply | Private Reply | To 1 | View Replies]

To: topher
Yes, the TRUTH slips out every now and then.

NO ONE and I repeat, NO ONE, is born a homosexual.

A homosexual is the result of emotional or physical ABUSE.

Is it any wonder that idiotic people DEFEND one’s right to be ABUSED and propagate the ABUSE on others? Liberals are miserable people. The more miserable people there are the BETTER THEY FEEL.

4 posted on 07/27/2010 11:29:01 AM PDT by nmh (Intelligent people recognize Intelligent Design (God).)
[ Post Reply | Private Reply | To 1 | View Replies]

To: topher

Interesting, but I also think that it may also be genetic and inherited. Sim[ply based on the fact that some of these people appear to have some kind of hormonal imbalance that makes them act effeminate and therefore easy to spot.


5 posted on 07/27/2010 11:29:15 AM PDT by Cacique (quos Deus vult perdere, prius dementat ( Islamia Delenda Est ))
[ Post Reply | Private Reply | To 1 | View Replies]

To: topher

Eighty percent of gay men say they were born that way...the remaining twenty percent say they got sucked into it...


6 posted on 07/27/2010 11:29:34 AM PDT by Snardius
[ Post Reply | Private Reply | To 1 | View Replies]

To: topher

The median age of first contact was 10 years old.

URL: http://www.lifesitenews.com/ldn/2010/jul/10072701.html

Age is NOT a barrier.

They’ll easily ABUSE an INFANT.


7 posted on 07/27/2010 11:30:07 AM PDT by nmh (Intelligent people recognize Intelligent Design (God).)
[ Post Reply | Private Reply | To 1 | View Replies]

To: topher
Article about California Biology Teacher and her lawsuit:

Fired Calif. professor exonerated in settlement of lawsuit against San Jose college district

From that FreeRepublic.com discussion thread is this quote from the San Jose Mercury News:

The professor, whose cause was championed by an alliance of conservative Christian attorneys, acknowledged that she suggested a connection between an expectant mother's stress and male homosexuality. But an offended student accused the instructor of offering her own, more extreme views, not suitable for classroom discussion.

It must be all these people in New Zealand causing this trouble... [Just joking]

8 posted on 07/27/2010 11:31:42 AM PDT by topher (Let us return to old-fashioned morality - morality that has stood the test of time...)
[ Post Reply | Private Reply | To 1 | View Replies]

To: topher
How does this explain homosexuals in ancient Rome or Egypt? How about explaining homosexuals in American Indian tribes when Europeans first arrived?

Homosexuals have existed since we first climbed down from trees or out of caves. Some folks would look on a hermaphrodite and say it is a mental disorder.

9 posted on 07/27/2010 11:32:58 AM PDT by Ben Mugged (Unions are the storm troopers of socialism.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nmh
I have also noticed, looking back at childhood acquaintances who turned out to be homosexual men, that there was often an overbearing, perhaps emasculating, mother figure involved.
10 posted on 07/27/2010 11:34:10 AM PDT by SonOfDarkSkies (Satan's greatest trick is convincing some men he doesn't exist!)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Cacique
Interesting, but I also think that it may also be genetic and inherited

How would such a gene propagate?

For millions of years, you are saying that a gene that was not conducive to heterosexual propagation somehow managed to remain in the population?

It's not a survivable gene. Maybe if humans had hermaphroditic reproduction, but...we don't. And artificial insemination is an exceedingly recent invention.

It's not genetic. There may be a predisposition based on hormonal production, but it would eventuate only under the right conditions, and then die out....because there would be no offspring. Or very few, in some unusual cases.

11 posted on 07/27/2010 11:35:02 AM PDT by Regulator (Watch Out!! The Americans are On the March!! America Forever, Mexico Never!)
[ Post Reply | Private Reply | To 5 | View Replies]

To: SonOfDarkSkies
that there was often an overbearing, perhaps emasculating, mother figure involved

Yup. As in, "emotional abuse".

12 posted on 07/27/2010 11:36:31 AM PDT by Regulator (Watch Out!! The Americans are On the March!! America Forever, Mexico Never!)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Cacique; massmike
Poster Massmike discussed the genetic connection on another thread. I will invite that poster to respond to your comments.

The remarks on the other thread (about the Fired California Biology Teacher) were above my knowledge.

So I will let that person respond if they desire too...

13 posted on 07/27/2010 11:36:47 AM PDT by topher (Let us return to old-fashioned morality - morality that has stood the test of time...)
[ Post Reply | Private Reply | To 5 | View Replies]

To: topher

What about those that didn’t undergo any trauma?


14 posted on 07/27/2010 11:38:09 AM PDT by stuartcr (Everything happens as God wants it to...otherwise, things would be different)
[ Post Reply | Private Reply | To 1 | View Replies]

To: topher

15 posted on 07/27/2010 11:38:31 AM PDT by Dem Guard
[ Post Reply | Private Reply | To 1 | View Replies]

To: nmh

The predatory homosexual activists pressure even elementary schools to teach about homosexual “choice.”

“Hi, Johnny. You’re in first grade, right? Do you like to play with Gary more than you do Jane? Jason more than Sarah? Well, then, you are probably what’s clled “gay.” It’s a very good choice. The best. Tell your parents and teachers and classmates, so everyone will know who you are. Don’t let anyone tell you it isn’t a good choice.”


16 posted on 07/27/2010 11:39:17 AM PDT by Seeing More Clearly Now
[ Post Reply | Private Reply | To 7 | View Replies]

To: Cacique; nmh
If you want to make the case for genetics you need far more than subjective estimates of appearance, since most behavior is shaped and learned in social contexts.

On the other hand it is well to avoid the common trap of seeking one all-encompassing explanation or cause. Behavior follows general laws but may evolve in given individuals for any of diverse reasons.

There is no doubt that much homosexual behavior comes from straightforward traumatic and other conditioning experiences at vulnerable developmental stages. It is also likely that given the broad range of possible hormonal aberrations and developmental anomalies, some people find themselves predisposed to same sex attraction.

17 posted on 07/27/2010 11:40:42 AM PDT by hinckley buzzard
[ Post Reply | Private Reply | To 5 | View Replies]

To: Ben Mugged
How does this explain homosexuals in ancient Rome or Egypt? How about explaining homosexuals in American Indian tribes when Europeans first arrived?

The same way you explain boys being molested by Afghan chiefs in today's world: by force. Boys who are morphologically effeminate are physically assaulted and impressed into homosexuality by other men trying to show their physical dominance.

In Rome, there was no stigma attached to the aggressor in such a relationship. In fact, it was a sign of virility, and proof of superiority. Such symbology still exists within the Latin world today, and throughout the Muslim world.

In other words, it's a marker of a crude, backward and atavistic society.

18 posted on 07/27/2010 11:42:20 AM PDT by Regulator (Watch Out!! The Americans are On the March!! America Forever, Mexico Never!)
[ Post Reply | Private Reply | To 9 | View Replies]

To: stuartcr
What about those that didn’t undergo any trauma?

Homosexuals make up about 1% of the population. Some people place the number as high as 2%, but current research indicates that this number is too high. I think it's clear that most (if not all) of the 1% of the population which is homosexual is that way because of some form of traumatic abuse.

If you want to argue that 0.15% of the population is "born gay" you could do so, of course. Personally I find it less than compelling. The bottom line, however, is that we have no need to reshape our society, our military recruitment practices, and our definition of marriage because some infinitesimal sliver of the population thinks we should.

Tyranny by the minority is not what this country is about.

19 posted on 07/27/2010 11:47:35 AM PDT by ClearCase_guy
[ Post Reply | Private Reply | To 14 | View Replies]

To: Regulator
Yup. As in, "emotional abuse".

I have a old acquaintance from youth (not a homosexual that I know of but never got married or had any girlfriends) whose mother was consistently overbearing.

I don't think anyone would "call" it abuse, but in my mind a consistent long-time influence that creates in a child an usually strong fear of life or instills a negative view of life is abuse. I think the mother in this case was merely trying to protect the child. But the effect on the child was to instill fear.

Like most relationships in life, this one flew under the radar such that no clear abuse was visible, but the mother clearly damaged the child.

And oddly enough, I don't think such behavior is rare (particularly in families where that father is missing or weak).

20 posted on 07/27/2010 11:48:31 AM PDT by SonOfDarkSkies (Satan's greatest trick is convincing some men he doesn't exist!)
[ Post Reply | Private Reply | To 12 | View Replies]

To: topher

It is a well known fact that most homosexuals are not born that way.

They just get sucked into it.


21 posted on 07/27/2010 11:50:53 AM PDT by Bubba_Leroy (The Obamanation Continues)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Ben Mugged

Just curious if you think that abuse never happened in any of those times and places? That seems to be the gist of your post. I’m not taking a side on the issue, but your logic seems flawed.


22 posted on 07/27/2010 11:52:18 AM PDT by brytlea (Jesus loves me, this I know.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: hinckley buzzard
I'll skip over your gobbledygook.

Homosexuality is not a trait when you are BORN. It is not present.


Homosexuality is a result of ABUSE; either emotional or physical. It's like a bad tasting family recipe that keeps circulating in the family. It is also an acquired behavior in other environments such as prison. Many black men are bisexual. They go in there as heterosexual but due to lack of self control, dabble with homosexual sex. When they are released they go back to their girl friends but some learned to enjoy sex with other males and continue to pursue it. Eventually they pick up aids and bring it home to their wife or girl friend. It's an ugly secret they don't want you to know.

When someone has the CORRECT emotional upbringing they will not be homosexuals. When boys are encouraged to be BOYS; they will be BOYS. When boys are encouraged to be GIRLS; this will help make them effeminate and making them a tempting morsel for a homosexual as they are rejected by males that are not effeminate.

Much has to do with upbringing and encouraging the proper ROLE of each gender. No one, is predisposed to same sex attraction. Admiring someone and looking up to someone is not SEXUAL ATTRACTION. Stupid adults often mistake that for homosexuality and actually ENCOURAGE homosexuality.

You may be happy sitting on the fence trying to please everyone with nonsense, but I won't be sitting next to you. There is nothing NORMAL about homosexuality and no one is born a homosexual. In summary, ABUSE evolves in many ways, physical, emotional, environment and eventually it will take its toll on a person.

23 posted on 07/27/2010 11:53:52 AM PDT by nmh (Intelligent people recognize Intelligent Design (God).)
[ Post Reply | Private Reply | To 17 | View Replies]

To: Regulator

I’d also be interested to see if there are any studies regarding the effects of bullying or being labeled as effeminate (for guys) by others. Boys who aren’t athletic, for instance, could have a rough time identifying themselves as male/manly in the face of constant ridicule and speculation. It might be easier psychologically to just give up and be what everybody says you are.

I see stuff going on in my kids’ school and I really feel for the kids who are “different” in non-sexual ways and it gets sexualized in the attitudes surrounding them.


24 posted on 07/27/2010 11:54:28 AM PDT by butterdezillion (.)
[ Post Reply | Private Reply | To 18 | View Replies]

To: nmh

Precisely - which is the main reason I’m not sure what course I will take if “don’t ask, don’t tell” is repealed. Can I continue to serve in an organization that forces me to recognize as true something which is clearly not true?

Colonel, USAFR


25 posted on 07/27/2010 11:54:41 AM PDT by jagusafr ("We hold these truths to be self-evident...")
[ Post Reply | Private Reply | To 4 | View Replies]

To: nmh

But haven’t you heard? “We don’t recruit”.

Bravo Sierra.

Colonel, USAFR


26 posted on 07/27/2010 11:55:57 AM PDT by jagusafr ("We hold these truths to be self-evident...")
[ Post Reply | Private Reply | To 7 | View Replies]

To: ClearCase_guy

I don’t know any personally, that I know of, but why do you think it’s clear? Wouldn’t you have to have an awful lot of data, going back centuries, for it to be clearly a case of traumatic abuse?


27 posted on 07/27/2010 11:57:41 AM PDT by stuartcr (Everything happens as God wants it to...otherwise, things would be different)
[ Post Reply | Private Reply | To 19 | View Replies]

To: stuartcr
What about those that didn’t undergo any trauma?

They're probably lying. I have known/met many, many homosexuals...male/female over the years. Each of them had a "story" to tell.

28 posted on 07/27/2010 11:58:46 AM PDT by LaineyDee (Don't mess with Texas wimmen!)
[ Post Reply | Private Reply | To 14 | View Replies]

To: hinckley buzzard

While I totally agree that in some cases this is absolutely correct, there are many people who were not/have not been abused and still are homosexual.

To simply say that being gay is a choice is extremely ignorant. If this were true, then you being hetero is also a choice right? And if you being hetero is a choice, then this would mean that you like both sexes, could have sex with either sex, but PREFER the opposite sex.

When I ask someone “straight” who says being gay is a “choice”, I would often reply, “To act on it is a choice. But attracted to it is not.”

In fact many men in the Priesthood who are gay, promise not to act on it due to their faith. However, personally that is like expecting a dog not to wag his tail when he sees his owner come home. Nuns often are better at not acting on their desire than priests.

But most people who are gay are born this way just as many people who are born “straight”. No straight person would say he simply chooses the opposite. They can’t help their desire for the opposite, it is this strong. The same can be stated for the homosexual. However, the former is the normal around 90% and the latter is demonized and around 10%. Of course, they have trouble admitting to being different.

And if it really is just a “choice” why on earth would all these gay people CHOOSE condemnation?? I mean, think about it...IF you liked the opposite sex as well, would you not want to FIT IN with society.

Another thing...

I guess all these “gay” animals from birds to our dogs have been sexually abused in their baby stages. You know there are a heck of a lot of same sex pairing in the animal kingdom.

And don’t pretend we are not from the animal kingdom because we are. We just are too full of ourselves to think otherwise.


29 posted on 07/27/2010 12:01:33 PM PDT by purpleporter
[ Post Reply | Private Reply | To 17 | View Replies]

To: topher

Another conclusion that didn’t need a study.


30 posted on 07/27/2010 12:02:01 PM PDT by wilco200 (11/4/08 - The Day America Jumped the Shark)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Cacique

...some of these people appear to have some kind of hormonal imbalance that makes them act effeminate and therefore easy to spot.

&&&
Have you not also encountered heterosexual men who acted effeminate and heterosexual women who seeme masculine? I have.


31 posted on 07/27/2010 12:02:37 PM PDT by Bigg Red (Palin/Hunter 2012 -- Bolton their Secretary of State)
[ Post Reply | Private Reply | To 5 | View Replies]

To: LaineyDee

Probably


32 posted on 07/27/2010 12:04:55 PM PDT by stuartcr (Everything happens as God wants it to...otherwise, things would be different)
[ Post Reply | Private Reply | To 28 | View Replies]

To: Regulator
There may be a predisposition based on hormonal production, but it would eventuate only under the right conditions, and then die out....because there would be no offspring. Or very few, in some unusual cases.

Not if as for most circumstances because homosexual behavior is frowned upon by most societies they may not be open about it and reproducing in higher numbers than you think. We simply don't know or have enough data. Political correctness has made research in this area a third rail for researchers and the fact is we have few clues on the subject.

33 posted on 07/27/2010 12:05:38 PM PDT by Cacique (quos Deus vult perdere, prius dementat ( Islamia Delenda Est ))
[ Post Reply | Private Reply | To 11 | View Replies]

To: topher

I anticipate that this is very important:

Sexual orientation and its basis in brain structure and function

Current evidence indicates that sexual differentiation of the human brain occurs during fetal and neonatal development and programs our gender identity—our feeling of being male or female and our sexual orientation as hetero-, homo-, or bisexual. This sexual differentiation process is accompanied by many structural and functional brain differences among these groups (1). In previous studies (2, 3), the Savic laboratory detected a sex-differentiated activation of the anterior hypothalamus in heterosexual men (HeM) and heterosexual women (HeW) and a sex-atypical, almost reversed, pattern of activation in homosexual men (HoM) and homosexual women (HoW). The hypothalamus (Fig. 1) is a small brain area located under the anterior commissure that is involved in many different functions, including reproduction.
http://www.pnas.org/content/105/30/10273.full


34 posted on 07/27/2010 12:05:51 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: stuartcr
You're looking at it backwards. For centuries, most societies (yes, even the Greeks and Romans for the most part) considered homosexuality among adult males to be abnormal. It was frowned upon and often treated very harshly. The historical data that you are looking for is quite clear: homosexuality was considered an aberration.

Now, in 1969, the APA decided to reclassify homosexuality and declare that it was not a mental illness. If effect, people are "born that way".

Personally, I'd like to see centuries of genetic studies that prove that people are "born that way" -- but no such studies exist. At all. No genetic trace has ever been verified.

So, we are back with the age old concept that homosexuals are "messed up people". Until somone comes up with compelling proof that this is not the case, I won't consider homosexuals to be either normal or "born that way".

35 posted on 07/27/2010 12:08:20 PM PDT by ClearCase_guy
[ Post Reply | Private Reply | To 27 | View Replies]

To: hinckley buzzard

fact is we have no clue as to why or where etc... Once in a while we get studies that give us a clue and then are suppressed by the establishment. Research into homosexuality has become a third rail in science and there is no funding for it by most governments.


36 posted on 07/27/2010 12:08:24 PM PDT by Cacique (quos Deus vult perdere, prius dementat ( Islamia Delenda Est ))
[ Post Reply | Private Reply | To 17 | View Replies]

To: Ben Mugged
Homosexuals have existed since we first climbed down from trees or out of caves.

So has abuse and exploitation of children, duh. Homosexuality is a disordered response to trauma, Stockholm syndrome, adopt the worldview and persona of the powerful abuser in order to insulate and encapsulate the trauma. The prey becomes the predator. Story as old as time.

37 posted on 07/27/2010 12:08:56 PM PDT by Valpal1 ("All that is necessary for the triumph of evil is that good men do nothing.")
[ Post Reply | Private Reply | To 9 | View Replies]

To: SonOfDarkSkies

Add in an inattentive father, the two I know had both.


38 posted on 07/27/2010 12:10:50 PM PDT by east1234 (Cut, Kill, Dig and Drill!)
[ Post Reply | Private Reply | To 10 | View Replies]

To: brytlea
Just curious if you think that abuse never happened in any of those times and places? That seems to be the gist of your post. I’m not taking a side on the issue, but your logic seems flawed.

I'm sure abuse has happened throughout the ages. I don't think childhood abuse is the root cause of homosexuality in the majority of instances. As another poster said to me Boys who are morphologically effeminate are physically assaulted and impressed into homosexuality by other men trying to show their physical dominance . The key point within his own argument is Boys who are morphologically effeminate admitting that some boys are born with effeminate tendencies. I personally believe that some homosexuality is a personal choice and other is genetics.

I am OK with either form as long as it is not rubbed in my face or causes me to lose my rights. I also don't believe the Government has any business in marriage including giving rights to those folks who are "married". Marriage is a sacrament of the church and as such should not be regulated or sanctioned by the Government. If any citizen has the right then all citizens should have the right to a civil union which should be regulated and sanctioned by the state governments. Civil unions should have no bearing on the religious bonding which is marriage.

39 posted on 07/27/2010 12:13:55 PM PDT by Ben Mugged (Unions are the storm troopers of socialism.)
[ Post Reply | Private Reply | To 22 | View Replies]

To: Eaker; humblegunner
0.3% identified as "something else."

Blogpimps.

40 posted on 07/27/2010 12:14:06 PM PDT by Tijeras_Slim (Live jubtabulously!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ClearCase_guy

Yes I understand that. I just don’t think you can honestly say that all homosexuals have been traumatized. That’s an awful lot of people throughout history. Besides, what about the first homosexuals? There had to be one of each sex, didn’t there? Who traumatized them?


41 posted on 07/27/2010 12:14:58 PM PDT by stuartcr (Everything happens as God wants it to...otherwise, things would be different)
[ Post Reply | Private Reply | To 35 | View Replies]

To: east1234

I have observed the same situations amongst my acquaintances.


42 posted on 07/27/2010 12:18:06 PM PDT by pbear8 (the Lord is my light and my salvation)
[ Post Reply | Private Reply | To 38 | View Replies]

To: Ben Mugged

Spartans glorified homosexuality, particularly in the military, and the solders initiated young boys into the “lifestyle”. (It was taught). Homosexuality was widespread since it was promoted in the culture (that defies genetics and proves it is learned!).

Greek politicians would on occasion try to protect their sons from being sexually used by men. It was uncommon practice to protect their sons, though....look into NAMBLA’s literature. They are probably Greekophiles.

Tribes who glorified homosexuality, produced a lot of homosexuals. Children were exposed to the ideas and their perception of nature is altered.

Those tribes that thought homosexuality was evil had little problems with homosexual behavior.

There is nothing genetic about this behavior. If there was “sexual orientation” than all “orientations” would be genetic which is a stupid idea. Beastiality, incest, babies being raped, etc,. are all caused by damage to the emotional and intellectual development of young children. That is why they call the first seven years the “formative years”. Just as you can abuse animals and “teach” them to do unnatural acts, you can do the same with children. Why do you think there are little four year old boys who will actually try to mount little girls. It is learned. It is not natural at that age. You can pervert nature easily with young vulnerable children.

There is a lot of good information on harm caused to young children (esp. boys) that are a result of emotional/or/and physical damage that perverts their nature.

As long as adults have the power to harm children, there will be homosexuality. All it takes is an ignorant,selfish, stupid or sick adult, and they have existed since the beginning of time.


43 posted on 07/27/2010 12:19:35 PM PDT by savagesusie
[ Post Reply | Private Reply | To 9 | View Replies]

To: stuartcr
Would it help if we got rid of the "all"? How about if we say: "Rresearch shows most homosexuals were traumatized as children, while a small number of homosexuals seem to be homosexual without any known traumatic experiences. We need a grant to ascertain the root cause for this subset."

The only thing I want made crystal clear is that homosexuality should not be normalized. When a society starts to see homosexuality as inconsequential, there is a problem.

44 posted on 07/27/2010 12:20:30 PM PDT by ClearCase_guy
[ Post Reply | Private Reply | To 41 | View Replies]

To: Cacique

Effeminate men and manly women are fighting an uphill battle when it comes to attracting the opposite sex.

I think most homosexuals were abused as children, and the rest just “gave up” competing with stronger males and more attractive females.


45 posted on 07/27/2010 12:22:02 PM PDT by ConservativeWarrior (In last year's nests, there are no birds this year.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: ClearCase_guy

OK. Since there must also be another reason for homosexuality, then it probably should be said, that we just don’t know. Maybe born that way, maybe not.


46 posted on 07/27/2010 12:23:43 PM PDT by stuartcr (Everything happens as God wants it to...otherwise, things would be different)
[ Post Reply | Private Reply | To 44 | View Replies]

To: purpleporter

>>I guess all these “gay” animals from birds to our dogs have been sexually abused in their baby stages. You know there are a heck of a lot of same sex pairing in the animal kingdom.<<

There is no homosexual behavior in animals because there is no emotion to sex. The act of mounting is domination. Plain and simple.
Only Humans and Dolphins have intercourse for pleasure. All others use it as a way to show underlings who is boss. That’s what you are seeing. Take any “same sex paring” in the animal kingdom and introduce a creature of the opposite sex and they will fight each other to procreate.

You’re humanizing them.


47 posted on 07/27/2010 12:23:59 PM PDT by netmilsmom (I am inyenzi on the Religion Forum)
[ Post Reply | Private Reply | To 29 | View Replies]

To: topher

We all knew this.

I’m just surprised that the study was “allowed” to be done.

Sounds like the guy that conducted the study was punished for it, as expected.

Can’t let the truth get out.


48 posted on 07/27/2010 12:25:00 PM PDT by MrB (The difference between a (de)humanist and a Satanist is that the latter knows who he's working for.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Ben Mugged

Well then, I don’t understand the post of yours I responded to.


49 posted on 07/27/2010 12:27:06 PM PDT by brytlea (Jesus loves me, this I know.)
[ Post Reply | Private Reply | To 39 | View Replies]

To: nmh

“NO ONE and I repeat, NO ONE, is born a homosexual. A homosexual is the result of emotional or physical ABUSE.”

Studies of identical twins prove that homosexuality is NOT genetic however that doesn’t mean you can’t be born gay. It is possible that it is a congenital disease possible due to some hormonal anomaly in the womb. Being born gay doesn’t make it “normal” anymore than someone born with mental retardation due to asphyxia is normal.


50 posted on 07/27/2010 12:30:43 PM PDT by Hacklehead (Liberalism is the art of taking what works, breaking it, and then blaming conservatives.)
[ Post Reply | Private Reply | To 4 | View Replies]


Navigation: use the links below to view more comments.
first 1-5051-100101-125 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson