Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

WikiLeaks founder uploads mystery file (WikiLeak Blackmails US and Blames US for Dead Informants)
New Europe ^ | July 31, 2010 | Andy Carling

Posted on 08/01/2010 2:55:37 AM PDT by tlb

Julian Assange has uploaded a file called “insurance” to the website and elsewhere. The file is 1.4 gigabytes, a thousand times larger than the recently leaked documents.

It is estimated that even the fastest computer would take millions of years to decrypt the file.

It is believed that Assange may have distributed the pass key to supporters, who could release it to the public.

The contents of the file are unknown. However, the recent release of documents, detailing the coalition’s experiences in Afghanistan, are not part of the 500,000 documents from Iraq, alleged to have been sent to WikLeaks by Bradley Manning.

Admiral. Mike Mullen, chairman of the Joint Chiefs of Staff, said that Assange and WikiLeaks may “already have on their hands the blood of some young soldier or that of an Afghan family.”

An angry Assange responded by asking “Why is the Pentagon focusing on the hypothetical blood on our hands, which has never been proved, rather than the real blood of the 20,000 deaths revealed in the documents?”

The top whistle blower, also criticized the US for “sloppy” and “unprofessional” security. WikiLeaks only uses code names internally for sources. Assange criticised the accessibility of the documents, saying, the information, including names of informants, “was available to every member of the U.S. military and every U.S. contractor — not just in Afghanistan — but all over the world. The military has acted in a disgraceful and careless way.”

Assange told reporters that he has plenty more material to be published, including “very significant” information on the BP oil spill and abuses in the US military, including sexual abuse.

In the meantime, the mystery file is being downloaded by many people, waiting for the key.

(Excerpt) Read more at neurope.eu ...


TOPICS: Crime/Corruption; Extended News; Government; Politics/Elections
KEYWORDS: assange; blackmail; files; insurance; julianassange; wikileaks
Navigation: use the links below to view more comments.
first 1-5051-54 next last
Tried to post the Wired story but that site is blocked as a source.

Possible bluff, but it's not like anybody in this administration will call him on it. Further even without the "insurance" I saw nothing to make me think anybody would move against him regardless.

Apparently though he has been stung by those who say he is getting Afghani informants killed.

1 posted on 08/01/2010 2:55:42 AM PDT by tlb
[ Post Reply | Private Reply | View Replies]

To: tlb; SunkenCiv
1.4 gigabytes encrypted by AES256, this must be a magnet for all Sigint organizations in the whole world.

How could a 22-year old get TS clearance??? and why was the data that he processed not compartmentalized?

2 posted on 08/01/2010 3:34:25 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Meanwhile, the Taliban appears to be carefully combing the documents that have been leaked. “We will investigate through our own secret service whether the people mentioned [in the Wikileaks documents] are really spies working for the U.S.,” Taliban spokesman Zabihullah Mujahid told Britain’s Channel 4 News. “If they are U.S. spies, then we know how to punish them.”

http://www.pcworld.com/article/202309/mystery_file_posted_to_wikileaks_afghan_page.html


3 posted on 08/01/2010 3:35:49 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: tlb

The man is either a stupid fool or writer has it wrong. No encryption software exists today that the government can’t break in a few days with their massively parallel arrayed decryption computers.


4 posted on 08/01/2010 3:41:40 AM PDT by BushCountry (I spoken many wise words in jest, but no comparison to the number of stupid words spoken in earnest)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Any service person can get a TS clearance, but they do not receive any more classified info for which they have a “need to know” to do their job. Everythign is segmented and compartmentalized. He may have been hacking and stealing info.


5 posted on 08/01/2010 3:42:09 AM PDT by shalom aleichem
[ Post Reply | Private Reply | To 2 | View Replies]

To: tlb

I wish Wikileaks would do something patriotic FOR the USA, expose Obamas past, his history, all his credential, the entire enchilada, from the Dunham side of the family selling B-29 plans to the Russians to the connections of the American Communist party and rumored financial backing from Castro and his 50 years dream of ultimate revenge upon America.


6 posted on 08/01/2010 3:43:01 AM PDT by Eye of Unk ("In a time of universal deceit, telling the truth becomes a revolutionary act" G.Orwell)
[ Post Reply | Private Reply | To 1 | View Replies]

To: tlb

this guy needs to get acquainted with the business end of a Mossad hushpuppy


7 posted on 08/01/2010 3:43:48 AM PDT by LeoWindhorse
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Why did it take the military four years to get MSRAP vehicles that have been around for fifty years? Why launch Challenger against your engineers in freezing weather? Why spend trillions on urban renewal, HUD, Fresh Start when for decades it has been shown not to work but make things worse?

Why have one CIA Director surfing Russian porn sites with his issued laptop and another NS Director smuggling out documents in his pants?

We’re talking government. You think anyone is going to fall for having a gay, battalion intel clerk get this stuff?


8 posted on 08/01/2010 3:45:53 AM PDT by Leisler ("Over time they create a legal system that plunders and a moral code that glorifies it." F. Bastiat)
[ Post Reply | Private Reply | To 2 | View Replies]

To: tlb; All

I’d love to hear from any legal experts on the forum if this guy can hypothetically be tried for treason and sentenced to the death penalty if found guilty. Although not likely to happen with this administration, I’d still like to know if it’s possible.

For the sake of national security though, it would be good if he disappeared.


9 posted on 08/01/2010 3:51:49 AM PDT by Rammer
[ Post Reply | Private Reply | To 1 | View Replies]

To: Leisler

there may have already been soemone who fell for that gay intel clerk...and that’s how the gay intel clerk got his information.


10 posted on 08/01/2010 4:15:04 AM PDT by RaceBannon (RON PAUL: THE PARTY OF TRUTHERS, TRAITORS AND UFO CHASERS!!!)
[ Post Reply | Private Reply | To 8 | View Replies]

To: BushCountry

If 1.4 gb is 1000 times larger than the previous release, that’d mean that the previous release was only 1.4 MB... small enough to fit on an old-fashioned (1980s) floppy drive.


11 posted on 08/01/2010 4:20:00 AM PDT by dangus
[ Post Reply | Private Reply | To 4 | View Replies]

To: Rammer
I’d love to hear from any legal experts on the forum if this guy can hypothetically be tried for treason and sentenced to the death penalty if found guilty. Although not likely to happen with this administration, I’d still like to know if it’s possible.

I am not any kind of expert.

But I recall about ten years ago, when I had to reactivate a clearance, I asked the FBI interviewer what the status of the Designated Counties List was, and he said with disgust, "It's not politically correct any more".

That said, regardless that I doubt anything will be done, the people responsible and the people in the press who republished it need to be whacked. Today.

12 posted on 08/01/2010 4:20:10 AM PDT by Gorzaloon (CNN:AP:etc:Today, President Obama's stool was firm and well-formed. One end was slightly pointed. ")
[ Post Reply | Private Reply | To 9 | View Replies]

To: AdmSmith

If they needed it for his job; and all communications types need high level security clearances, they would have a background investigation and if passed, given the appropriiate clearance. I’d have to guess there may have been some in that age group on the USS Pueblo. The reserve unit I joined in the late ‘60s was a group of cryptologists. I had a TS by 20 y/o.


13 posted on 08/01/2010 4:23:07 AM PDT by Tucson (Sometimes we feel guilty because we are guilty)
[ Post Reply | Private Reply | To 2 | View Replies]

To: AdmSmith
Reported on Fox & FRiends this morning that they now believe a civilian installed encrypting devise to help him get documents.
14 posted on 08/01/2010 4:29:12 AM PDT by mware (F-R-E-E, that spells free, Free Republic.com baby.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Tucson

Same here in the early 70’s. US Army 31S


15 posted on 08/01/2010 4:37:50 AM PDT by mazda77 (Rubio for US Senate - West FL22nd - JD Hayworth - US Senate)
[ Post Reply | Private Reply | To 13 | View Replies]

To: Gorzaloon
"That said, regardless that I doubt anything will be done, the people responsible and the people in the press who republished it need to be whacked. Today."

Oh, they will. They most certainly will. These poor kids cannot fully appreciate what they've unleashed. Young Mr. Assange's infantile attempts at deflection will not save him. It may take years, but eventually somebody's surviving son or daughter will step from the mists of time, and avenge their parent's bloody betrayal. Welcome to the Dark side, Mr. Assange. You tried hard enough to get there. "Vengeance is a dish best served cold, and savored with time."
16 posted on 08/01/2010 4:42:47 AM PDT by PowderMonkey (Will work for ammo)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Tucson

The reserve unit I joined in the late ‘60s was a group of cryptologists. I had a TS by 20 y/o.
= = = = = = = = = = = = = = = = = = = = = =
I went to CT”R” SCO 1957 and had full BI while in Boot Camp (17yo) and received INT TS around 19 (if not earlier, not sure what was reqd for CT SCO) while aboard ship as RM and working as Cryptographer and around TS material...as they said, though most was need to know or ‘eyes only’.


17 posted on 08/01/2010 4:58:44 AM PDT by xrmusn ((6/98 ) FIRE ALL INCUMBENTS)
[ Post Reply | Private Reply | To 13 | View Replies]

To: tlb

Assange is not just ni fear of US government. The Aussie military intelligence hierarchy have been hounding him weeks before he first announced the preannouncement of the big leak.

Fair to say the military intelligence in the Anglosphere and Commonwealth all have him on their radar.


18 posted on 08/01/2010 4:59:19 AM PDT by JerseyHighlander
[ Post Reply | Private Reply | To 1 | View Replies]

To: RaceBannon

Can’t remember. Gays from elite British schools, ‘meeting’ American elite gays, all passing on to the Soviets.


19 posted on 08/01/2010 5:06:02 AM PDT by Leisler ("Over time they create a legal system that plunders and a moral code that glorifies it." F. Bastiat)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Leisler

Philby. Never turn your back on a man who calls himself “Kim.” Nyuk...nyuk...nyuk.


20 posted on 08/01/2010 5:11:01 AM PDT by PowderMonkey (Will work for ammo)
[ Post Reply | Private Reply | To 19 | View Replies]

To: tlb

“WikiLeak Blackmails US and Blames US for Dead Informants”

He’s engaging in the same tactics used by Democrats.
(Another ally of the Democrat Party.)

IMHO


21 posted on 08/01/2010 5:16:29 AM PDT by ripley
[ Post Reply | Private Reply | To 1 | View Replies]

To: tlb

I read some of these action reports yesterday. Hard to see how the vast bulk of what I read could be of use to the enemy. Maybe some names in there, but I did not see any.

It’s also very hard to see how this is going to galvanize opposition to the war.

I think this guy’s efforts are as likely to escalate the war as help bring it to an end. Neither is very likely, but it would be interesting if his efforts backfired and actually caused an escalation of the war.


22 posted on 08/01/2010 5:17:17 AM PDT by Brilliant
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
How could a 22-year old get TS clearance???

The application only checks your background to the age of 18.

It may also be that he didn't have a TS clearance - it may be that the Washington Post has no idea that there's any difference between a TS and an S clearance, and that any classified data is always compartmentalized in some manner by the "Need To Know" paperwork. There is no access without the proper clearance and the proper NTK.

23 posted on 08/01/2010 5:24:24 AM PDT by mvpel (Michael Pelletier)
[ Post Reply | Private Reply | To 2 | View Replies]

To: tlb

bookmark for later read


24 posted on 08/01/2010 5:31:50 AM PDT by IllumiNaughtyByNature (3(0|\|0/\/\1($ 101: (4P174L1$/\/\ R3QU1r3$ (4P174L. Could it be any more simple?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Leisler

Burgess and Blum and several others

Incl the Canadian Ambassador to Egypt


70 Members of UK Parliament were alleged by KGB defectors to be secret members of (ie spying for) the UK Communist Party.

A recent FR post LISTED 70 members of the US Congress as confirmed members of the Socialist Party USA...........

Wonder why we are going down the road we are .........??????????????


25 posted on 08/01/2010 5:35:42 AM PDT by DontTreadOnMe2009 (So stop treading on me already!)
[ Post Reply | Private Reply | To 19 | View Replies]

To: BushCountry
Here is a great article about how long it would take to crack a password, using "brute force"
26 posted on 08/01/2010 5:39:35 AM PDT by IllumiNaughtyByNature (3(0|\|0/\/\1($ 101: (4P174L1$/\/\ R3QU1r3$ (4P174L. Could it be any more simple?)
[ Post Reply | Private Reply | To 4 | View Replies]

To: IllumiNaughtyByNature
From my article above:

Project Bovine RC5-64 possibly the fastest computer on earth has recently reached a speed of 76.1 Billion passwords per second!

27 posted on 08/01/2010 5:42:10 AM PDT by IllumiNaughtyByNature (3(0|\|0/\/\1($ 101: (4P174L1$/\/\ R3QU1r3$ (4P174L. Could it be any more simple?)
[ Post Reply | Private Reply | To 26 | View Replies]

To: tlb

No sympathy with Assange, but the trick of posting encrypted information on the web to discourage official retribution may be useful for others with more worthy causes.


28 posted on 08/01/2010 5:49:35 AM PDT by Grut
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Age has nothing to do with TS clearance. It is all about the background check and interview and today a lot of those are done by third party for the military.


29 posted on 08/01/2010 5:50:34 AM PDT by surfer (To err is human, to really foul things up takes a Democrat, don't expect the GOP to have the answer!)
[ Post Reply | Private Reply | To 2 | View Replies]

To: tlb
Assange told reporters that he has plenty more material to be published, including “very significant” information on the BP oil spill and abuses in the US military, including sexual abuse.

Would he happen to have any birth certificates in his file?

30 posted on 08/01/2010 5:51:35 AM PDT by Mannaggia l'America
[ Post Reply | Private Reply | To 1 | View Replies]

To: IllumiNaughtyByNature

The chart you showed says the toughest encryption would take 83.5 days to crack at 1 billion passwords per second. Divide your 83.5 / 76.1 = 1.09 days for Project Bovine to crack.


31 posted on 08/01/2010 5:51:41 AM PDT by BushCountry (I spoken many wise words in jest, but no comparison to the number of stupid words spoken in earnest)
[ Post Reply | Private Reply | To 27 | View Replies]

To: BushCountry
The man is either a stupid fool or writer has it wrong. No encryption software exists today that the government can’t break in a few days with their massively parallel arrayed decryption computers.

Maybe. But suppose all that's in there is random numbers: could a government that wanted to move against Assange be sure it was that, and not data that their decryption efforts had failed to read?

32 posted on 08/01/2010 5:59:25 AM PDT by Grut
[ Post Reply | Private Reply | To 4 | View Replies]

To: Grut

Wikipedia says this is the worlds current fastest computer:

In November 2009, the AMD Opteron-based Cray XT5 Jaguar at the Oak Ridge National Laboratory was announced as the fastest operational supercomputer, with a sustained processing rate of 1.759 PFLOPS.[6] [7]

I’m sure somewhere the military has stuff that’s faster,
if not the same.


33 posted on 08/01/2010 6:47:48 AM PDT by Mmogamer (I refudiate the lamestream media, leftists and their prevaricutions.)
[ Post Reply | Private Reply | To 32 | View Replies]

To: tlb

Was Wikileaker Bradley Manning Betrayed By His Queer Identity?

Was Wikileaker Bradley Manning Betrayed By His Queer Identity?It’s been speculated that alleged Army leaker, PFC Bradley Manning, is transgendered. We’ve found evidence that strongly suggests Manning has some sort of LGBT identity, and that the man who snitched on him exploited this to win his trust.

Twenty-two year-old army intelligence specialist Bradley Manning was arrested May 26th for allegedly leaking the notorious Iraq Apache attack helicopter video and more than a quarter million classified State Department documents to secret-sharing website Wikileaks. He was turned in by his confidant, ex-hacker Adrian Lamo. Lamo then gave logs of his chats with Manning to Wired’s Kevin Poulsen, who broke the story of Manning’s arrest.

There are many unanswered questions about this story—the largest of which is: Why would Manning trust an ex-hacker he had never met enough to confess, almost immediately, via instant message, his terrible Wikileaks secret—something he knew could put him in prison for a long time? Lamo told Salon that Manning found him by doing a Twitter search for “Wikileaks,” and that he doesn’t know what motivated his confession. Yeah fucking right.

Wired suggested Manning sensed a “kindred-spirit in the ex-hacker” Lamo. But Manning and Lamo also apparently share something stronger than a fondness for breaking into computer systems: An LGBT identity. Lamo is an out bisexual, while an increasing number of clues suggest that Manning is, if not transgendered, deeply uncertain about his sexuality and/or gender. Interviews with Lamo’s acquaintances and a close reading of the chat logs suggest Lamo traded on this identity to exploit Manning at his most vulnerable, as questions about his sexuality were unbearably pressing on his personal and professional lives......

http://gawker.com/5571388/was-wikileaker-bradley-manning-betrayed-by-his-queer-identity


34 posted on 08/01/2010 7:22:37 AM PDT by KeyLargo
[ Post Reply | Private Reply | To 1 | View Replies]

To: BushCountry
Extrapolating a little here, but say JA used a combination of mixed uppercase, lowercase, symbols letters and numbers and took it out to 32 characters (the higest I've seen but probably not the highest available) then it's going to be quite a while. If password length is 8 characters at this level the combinations are 7.2 Quadrillion. I dont have a calculator large enough to guess what the combos would be at 32 then divide by the rate at which Bovine could attack it.

That being said, I am sure that JA is aware of this and using the best possible methods that he is aware of.

Can you run the numbers to see what would happen using the bove parameters?

Besides, the govt. will eventually crack it (probably 4Chan also) to see what it is, if it's legit, then they will know if he is bluffing or going "all in."

Thoughts?

35 posted on 08/01/2010 7:45:48 AM PDT by IllumiNaughtyByNature (3(0|\|0/\/\1($ 101: (4P174L1$/\/\ R3QU1r3$ (4P174L. Could it be any more simple?)
[ Post Reply | Private Reply | To 31 | View Replies]

To: IllumiNaughtyByNature

Two problems, one is that it almost impossible to create a random key no matter how hard you try. Second, is that I suspect that the government has the backdoors for all currently available encryption programs.

Next, it would take the maximum length of time required under impossible long odds. The computer has a 1 in 20 chance of guessing the password after just 5% of the time required. A 1 in 4 chance of having guessed the password after 25% of the time has expired, etc...


36 posted on 08/01/2010 8:09:58 AM PDT by BushCountry (I spoken many wise words in jest, but no comparison to the number of stupid words spoken in earnest)
[ Post Reply | Private Reply | To 35 | View Replies]

To: AdmSmith
How could a 22-year old get TS clearance??? and why was the data that he processed not compartmentalized?

I had a TS NOFORN in Europe in 1960.

They checked everyone who knew me in high school
and my summer time jobs and what neighborhood I drove through.

I was 21.

The question of compartmentalization is right on target how ever.

The question that should have been asked was :

What was his need to know.


37 posted on 08/01/2010 8:23:08 AM PDT by Uri’el-2012 (Psalm 119:174 I long for Your salvation, YHvH, Your law is my delight.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: AdmSmith

And where was Counter Intel? How did he have a blog and an active Facebook account?


38 posted on 08/01/2010 8:53:44 AM PDT by cookcounty ("Today's White House reporters seem one ball short of a ping pong scrimmage.")
[ Post Reply | Private Reply | To 2 | View Replies]

To: shalom aleichem
"Any service person can get a TS clearance,"

Untrue, totally.

39 posted on 08/01/2010 8:54:52 AM PDT by cookcounty ("Today's White House reporters seem one ball short of a ping pong scrimmage.")
[ Post Reply | Private Reply | To 5 | View Replies]

To: cookcounty

Not “totally”, assuming record is clear, doesn’t hang out with Marxists, radical professors, live abroad, not have a birth certificate, have multiple social security numbers, etc. yea, that may put a block on your background check.
BTW the Private who leaked the stuff is a radical Gay.


40 posted on 08/01/2010 9:03:03 AM PDT by shalom aleichem
[ Post Reply | Private Reply | To 39 | View Replies]

To: tlb
Julian Assange has uploaded a file called “insurance” to the website and elsewhere. The file is 1.4 gigabytes, a thousand times larger than the recently leaked documents.

It is estimated that even the fastest computer would take millions of years to decrypt the file.

Textbook example for a non sequitur.

The file size has absolutely nothing to do with how long it would take to break the encryption code. A 1kB file encrypted with the same key would take exactly as long to decrypt.

41 posted on 08/01/2010 10:35:10 AM PDT by Moltke (panem et circenses)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
How could a 22-year old get TS clearance???

I held a TS w/SBI at 18.

42 posted on 08/01/2010 11:01:59 AM PDT by Petruchio
[ Post Reply | Private Reply | To 2 | View Replies]

To: Moltke

If the file is too short it can not be decrypted as there would be several possible solutions. In order to have a definite solution the corpus should have a certain minimum length.


43 posted on 08/01/2010 11:05:27 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 41 | View Replies]

To: AdmSmith

“Top Secret” clearances are a dime a dozen in our government. The recent Washington Post investigation revealed there are over 800,000 people who have them. What’s more absurd is that they are given for every job imaginable inside the federal beast - everything from an analyst at the Pentagon down to the guy who makes travel arrangements for the Department of Housing and Urban Development.


44 posted on 08/01/2010 11:52:06 AM PDT by conimbricenses (Red means run son, numbers add up to nothing.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: AdmSmith

Yes, of course. 1kB was extreme just to make a point. Make it 1 MB or 10MB then.


45 posted on 08/01/2010 12:08:17 PM PDT by Moltke (panem et circenses)
[ Post Reply | Private Reply | To 43 | View Replies]

To: BushCountry

I take it you haven’t studied encryption.


46 posted on 08/01/2010 2:14:16 PM PDT by billybudd
[ Post Reply | Private Reply | To 4 | View Replies]

To: Rammer

Why? He’s exposing the inanity of this war, which the media and the military are trying to keep hidden. Sounds more like heroism than treason.


47 posted on 08/01/2010 2:19:27 PM PDT by billybudd
[ Post Reply | Private Reply | To 9 | View Replies]

To: billybudd

I don’t think any encryption algorithm is safe against a multi-million dollar supercomputer array system designed to crack encrypted files.

I don’t know what the dollar value is of the most advance technology the government current employs, but I know there are massively arrayed super-fast computers dedicated to breaking encryption. I doubt anything this guy used would be safe. Especially, since the story says he handed the key out to several people. There is no such thing as a secret if two if more than one person knows.


48 posted on 08/01/2010 2:36:01 PM PDT by BushCountry (I spoken many wise words in jest, but no comparison to the number of stupid words spoken in earnest)
[ Post Reply | Private Reply | To 46 | View Replies]

To: BushCountry
In any case, the purpose of the encryption in this case is not to prevent the government from seeing it, it's to prevent the media and general public from seeing it. The point is that his supporters will release the keys to the public so they can read the documents if he is killed by government agents.

He may have even sent a copy of the key to the government to let them know how damaging the documents are.
49 posted on 08/01/2010 4:45:40 PM PDT by billybudd
[ Post Reply | Private Reply | To 48 | View Replies]

To: AdmSmith; Ernest_at_the_Beach; ShadowAce; texas booster
The file is 1.4 gigabytes, a thousand times larger than the recently leaked documents. It is estimated that even the fastest computer would take millions of years to decrypt the file.
The estimate is from someone who has never used anything north of an abacus. :') Thanks AdmSmith!
50 posted on 08/01/2010 5:57:58 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 2 | View Replies]


Navigation: use the links below to view more comments.
first 1-5051-54 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson