Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

NKorea's Kim, heir apparent son at lavish parade
Fox News ^ | 10/10/10

Posted on 10/10/2010 12:28:11 AM PDT by TigerLikesRooster

NKorea's Kim, heir apparent son at lavish parade

Published October 10, 2010 | Associated Press

Clapping, waving and even cracking a smile, Kim Jong Il's son and heir apparent joined his father Sunday at a massive military parade in his most public appearance since being unveiled as North Korea's next leader.

Kim Jong Un, dressed in a dark blue civilian suit, sat next to his father on an observatory platform at Kim Il Sung Plaza as tanks carrying rocket-propelled grenades and long-range missiles rolled by as part of celebrations marking the 65th anniversary of the reclusive state's ruling Workers' Party.

It was a momentous public debut for Kim Jong Un less than two weeks after he was made a four-star general in the first in a series of appointments that set him firmly on the path to succession, which would carry the Kim dynasty over the communist country into a third generation.

(Excerpt) Read more at foxnews.com ...


TOPICS: Extended News; Foreign Affairs; News/Current Events
KEYWORDS: coup; coupdetat; kimjongeun; nkorea; parade; powerstruggle; succession
Navigation: use the links below to view more comments.
first 1-5051-57 next last

1 posted on 10/10/2010 12:28:18 AM PDT by TigerLikesRooster
[ Post Reply | Private Reply | View Replies]

To: TigerLikesRooster; AmericanInTokyo; Steel Wolf; nuconvert; MizSterious; nw_arizona_granny; ...

Junior pig sightings



Pre-celebration extravaganza on Oct. 9


2 posted on 10/10/2010 12:32:11 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster
Here's the sob. Where's his spiffy General's suit?


3 posted on 10/10/2010 12:32:32 AM PDT by BobP (The piss-stream media - Never to be watched again in my house)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

More pictures of junior pig


4 posted on 10/10/2010 12:35:01 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 2 | View Replies]

To: TigerLikesRooster

Practically emotionless face, just like this father. Do you think he’ll be as bad, or possibly worse than ‘lil Chia Pet?


5 posted on 10/10/2010 12:35:55 AM PDT by wastedyears (Know this, I will return to this land... rebuild where the ruins did stand)
[ Post Reply | Private Reply | To 1 | View Replies]

To: wastedyears

Certainly looks like he hasn’t pushed himself away from the buffet table!


6 posted on 10/10/2010 12:39:29 AM PDT by hoagy62 (.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: wastedyears
He is taking it over at a time when the situation is a lot more unstable than when his dad took it over. He is also under a lot of time pressure. He has to turn things around fast. He is not a type of going down without a fight.

Expect him to force things only to backfire on him.

7 posted on 10/10/2010 12:41:38 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 5 | View Replies]

To: hoagy62

To him, “all you can eat” must have been true for all his life.:-)


8 posted on 10/10/2010 12:42:36 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 6 | View Replies]

To: TigerLikesRooster
This family seems to be made up of some of the most repulsive looking Koreans I've ever seen. I guess their physical appearance is a reflection of the evil in their minds.
9 posted on 10/10/2010 12:43:47 AM PDT by ThermoNuclearWarrior (Let's get Christine O'Donnell elected to the U.S. Senate November, 02!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

Ahh yes...the old "Guarding the Gates of Heaven" sword move from Joseon Sebeop - 조선세법/朝鮮勢法...brings back memories...;)
10 posted on 10/10/2010 12:47:52 AM PDT by Tainan (Cogito, ergo conservatus)
[ Post Reply | Private Reply | To 2 | View Replies]

To: TigerLikesRooster

Parade Photos


11 posted on 10/10/2010 12:49:58 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Tainan

Damn, don’t know what to fear most, the kick or the sword!


12 posted on 10/10/2010 12:53:52 AM PDT by The Cajun
[ Post Reply | Private Reply | To 10 | View Replies]

To: TigerLikesRooster

I swear he looks exactly like portraits of his grandfather in his younger years... without the spark of intelligence in the eyes, that is.


13 posted on 10/10/2010 12:56:07 AM PDT by sinanju
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tainan
As far as I know, "high kick" is not a part of its repertoire.:-)

Maybe N. Korean Pleasure Group variation? :-)

14 posted on 10/10/2010 12:56:16 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 10 | View Replies]

To: sinanju
Probably right. He got the beef, but the experience? Questionable.

However, since he has no other significant credential, the resemblance to his grand dad will be highlighted again and again by NK state media.

15 posted on 10/10/2010 12:58:17 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 13 | View Replies]

To: BobP

They have their boy president; we have ours.


16 posted on 10/10/2010 1:03:46 AM PDT by DooDahhhh
[ Post Reply | Private Reply | To 3 | View Replies]

To: TigerLikesRooster

He’s the only member of the brood who isn’t a complete degenerate. He spent his school and university years in Europe pretending to be the son of the Nork embassy driver.

I’d say there’s zero chance of him being able to hold onto the reins when his dad kicks. Unless it’s because nobody else really wants the job. In which case, he may survive for sometime as a figurehead for the military.


17 posted on 10/10/2010 1:07:33 AM PDT by sinanju
[ Post Reply | Private Reply | To 15 | View Replies]

To: TigerLikesRooster
Kim Jong Un=SPAULDING.......
18 posted on 10/10/2010 1:08:10 AM PDT by cmsgop ( I don't think Rick Sanchez can handle any more "Breaking News" (Credit Market Ticker))
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

I recently read “Escaping North Korea”.

Absolutely, unbelievably grim, grinding, hopeless and starving existence for most people there. Not to mention short. Their healthcare system is simple—you get sick, you die.

Makes Fidel’s Cuba sound like the land of milk and honey by comparison.


19 posted on 10/10/2010 1:11:12 AM PDT by sinanju
[ Post Reply | Private Reply | To 15 | View Replies]

To: sinanju
Once it is open and we can see it with our own eyes, the shock will be many times higher than we already feel from reading accounts.
20 posted on 10/10/2010 1:15:03 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 19 | View Replies]

To: BobP

It doesn’t fit him. Too fat!


21 posted on 10/10/2010 1:41:48 AM PDT by Old Retired Army Guy (tHE)
[ Post Reply | Private Reply | To 3 | View Replies]

To: TigerLikesRooster
He has had plastic surgery. And he is wearing elevator heels.

"MINI ME!"

Video from Japanese TV just now showing Junior Pig, the Boy-King --just hit the white triangle at link to stream. Disgusting. Sad. LINK

22 posted on 10/10/2010 1:53:04 AM PDT by AmericanInTokyo (Worldwide Press Spin, Nov. 3rd? "America is RACIST(sic)". Take that to the bank. Ink already ready.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: TigerLikesRooster

He wont last a year after the old man is dead....he will fall in a coup.


23 posted on 10/10/2010 2:14:05 AM PDT by Dog
[ Post Reply | Private Reply | To 20 | View Replies]

To: Old Retired Army Guy
Re: The Little General's uniform -- It doesn’t fit him. Too fat!

--------------------------------

It's his head that bothers me!

Kim Jong-un at a parade in Pyongyang-2

24 posted on 10/10/2010 3:01:19 AM PDT by BobP (The piss-stream media - Never to be watched again in my house)
[ Post Reply | Private Reply | To 21 | View Replies]

To: hoagy62

“Certainly looks like he hasn’t pushed himself away from the buffet table!”

Looks like he ate the table, too.

Hell truly can’t swallow this scum soon enough.


25 posted on 10/10/2010 3:15:56 AM PDT by Levante
[ Post Reply | Private Reply | To 6 | View Replies]

To: TigerLikesRooster

It’s amazing how much he resembles his Grandfather. One can only wonder if he is half the Stalinist the old man was...

Time will tell.


26 posted on 10/10/2010 3:54:39 AM PDT by Bean Counter (Now what kind of a geroo are you anyway?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster
Kim Jong Un, dressed in a dark blue civilian suit...

How long time would it take until we can see him in another suit and his father in something else?

27 posted on 10/10/2010 3:55:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: hoagy62
Somebody needs to sign him up at Bally’s Fitness.
28 posted on 10/10/2010 3:59:12 AM PDT by Recon Dad ( "Don't forget, incoming fire has the right of way")
[ Post Reply | Private Reply | To 6 | View Replies]

To: AdmSmith

Don’t mind seeing both the dad and the kid on the autopsy table.


29 posted on 10/10/2010 3:59:41 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 27 | View Replies]

To: Tainan

An example of North Korea’s crack troops.


30 posted on 10/10/2010 4:39:38 AM PDT by Nakota
[ Post Reply | Private Reply | To 10 | View Replies]

To: TigerLikesRooster

The general next to him is his uncle?


31 posted on 10/10/2010 4:41:21 AM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dog

“He wont last a year after the old man is dead....he will fall in a coup.”

My feeling too


32 posted on 10/10/2010 4:42:46 AM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 23 | View Replies]

To: TigerLikesRooster

I have to give the North Korean’s credit.They sure do know how to put on a parade.

This is something Obama is trying to learn.


33 posted on 10/10/2010 5:14:04 AM PDT by puppypusher (The World is going to the dogs.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: puppypusher
Definitely some pretty troopers to be sure.. and wearing thigh highs.
34 posted on 10/10/2010 5:53:14 AM PDT by Mmogamer (I refudiate the lamestream media, leftists and their prevaricutions.)
[ Post Reply | Private Reply | To 33 | View Replies]

To: nuconvert

I don’t think so.


35 posted on 10/10/2010 8:10:28 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 31 | View Replies]

To: TigerLikesRooster; Jet Jaguar; monkapotamus; Cindy; AmericanInTokyo; All

North Korea rockettes LOL!


36 posted on 10/10/2010 8:31:56 AM PDT by SevenofNine ("We are Freepers, all your media belong to us ,resistance is futile")
[ Post Reply | Private Reply | To 2 | View Replies]

To: AmericanInTokyo

Yup that Mini Me LOL

MINI ME Grandpa the dude does look like dear ole Grandpa LOL!


37 posted on 10/10/2010 8:33:14 AM PDT by SevenofNine ("We are Freepers, all your media belong to us ,resistance is futile")
[ Post Reply | Private Reply | To 22 | View Replies]

To: TigerLikesRooster

Hey Tiger so is same son that like NBA Basketball or who is Eric Clapton fan LOL!


38 posted on 10/10/2010 8:38:14 AM PDT by SevenofNine ("We are Freepers, all your media belong to us ,resistance is futile")
[ Post Reply | Private Reply | To 4 | View Replies]

To: sinanju

Reported “plastic surgery” on Kim-un..... to look more like his grandfather...in order to secure a visual for the N.Korean people. Experts have looked at before and after ohotos of Kim and say it is highly possible this was done.


39 posted on 10/10/2010 8:38:44 AM PDT by caww
[ Post Reply | Private Reply | To 13 | View Replies]

To: Dog
Astute observation.

It is being planned as we speak, rest assured.

There is more than one faction already active within the KWP and the KPA, and they have the means, the brains and the will to do so.

40 posted on 10/10/2010 8:39:55 AM PDT by AmericanInTokyo (Worldwide Press Spin, Nov. 3rd? "America is RACIST(sic)". Take that to the bank. Ink already ready.)
[ Post Reply | Private Reply | To 23 | View Replies]

To: AmericanInTokyo
O Kuk-ryol, one time left-hand man of Kim Jong-il, who commanded crack special forces, was apparently pushed aside after Kim Jong-eun tried to wrest from O the control of lucrative hard-cash earning operation O's organization has been in charge of.

This could be a big potential problem.

41 posted on 10/10/2010 8:46:11 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 40 | View Replies]

To: Recon Dad

OR JENNY Craig LOL!


42 posted on 10/10/2010 9:23:29 AM PDT by SevenofNine ("We are Freepers, all your media belong to us ,resistance is futile")
[ Post Reply | Private Reply | To 28 | View Replies]

To: TigerLikesRooster

OH OH Crack in regime Most likely

I give Chia Chub a year after dear ole dad kick the bucket


43 posted on 10/10/2010 9:24:42 AM PDT by SevenofNine ("We are Freepers, all your media belong to us ,resistance is futile")
[ Post Reply | Private Reply | To 41 | View Replies]

To: TigerLikesRooster
If anyone sends out a team to take care of Junior in an inevitable power struggle, General O's men will indeed be the ones to get the job done. But they will come up against brutal resistance by Kim Jong il's elite protection service, most of those guys trained at a level of 8 confirmed kills, through the heart, per minute with small arms weaponry, and no no doubt arrayed around KJU 24/7 with several outer and inner perimeters.

in my humble opinion

Monitoring Jong-chol's and Jong-nam's movements and attitudes these days will also prove to be rather interesting.

44 posted on 10/10/2010 9:42:17 AM PDT by AmericanInTokyo (Worldwide Press Spin, Nov. 3rd? "America is RACIST(sic)". Take that to the bank. Ink already ready.)
[ Post Reply | Private Reply | To 41 | View Replies]

To: TigerLikesRooster

“Super K” bogus notes, correct, produced in downtown Pyongyang and then diplomatic pouched around the globe? That shop. Oh yes. Lucrative. Lucrative indeed.


45 posted on 10/10/2010 9:45:34 AM PDT by AmericanInTokyo (Worldwide Press Spin, Nov. 3rd? "America is RACIST(sic)". Take that to the bank. Ink already ready.)
[ Post Reply | Private Reply | To 41 | View Replies]

To: SevenofNine; TigerLikesRooster

46 posted on 10/10/2010 9:50:45 AM PDT by AmericanInTokyo (Worldwide Press Spin, Nov. 3rd? "America is RACIST(sic)". Take that to the bank. Ink already ready.)
[ Post Reply | Private Reply | To 42 | View Replies]

To: AmericanInTokyo

SO it be like Kill Bill VOl 1 and mixture of Lion in Winter NK style LOL!


47 posted on 10/10/2010 9:58:51 AM PDT by SevenofNine ("We are Freepers, all your media belong to us ,resistance is futile")
[ Post Reply | Private Reply | To 44 | View Replies]

To: AmericanInTokyo
most of those guys trained at a level of 8 confirmed kills, through the heart, per minute with small arms weaponry

Shall I even ask how they obtained that certification?

48 posted on 10/10/2010 10:00:26 AM PDT by garbanzo (Government is not the solution to our problems. Government is the problem.)
[ Post Reply | Private Reply | To 44 | View Replies]

To: garbanzo

They use North Korean political prisoners, for live human target practice, in their training facilities, using knifes, bayonets, handguns and assault weapons. They snuf them out like (snap!) “that!”. Then bring in a fresh crew for practice. I would not doubt that part of Kim Jong Eun’s political training may have already been that he was given given a 7.62 Tokarev and told to shoot a North Korean concentration camp prisoner (civilian), at point blank range, just to toughen him up and make him a cold, calculating killer that he will need to be to inherit the DPRK from Kim il Sung (murderer) and Kim Jong il (murderer). Would not suprise me at all if the Party internal elite required this of him already.


49 posted on 10/10/2010 10:10:20 AM PDT by AmericanInTokyo (Worldwide Press Spin, Nov. 3rd? "America is RACIST(sic)". Take that to the bank. Ink already ready.)
[ Post Reply | Private Reply | To 48 | View Replies]

To: AmericanInTokyo

What I’ve always wondered about the Super-K notes is this ...if I walked with a bunch of them to a high-level bank (as in, say I am in a large bank in New York or Dubai or Berlin; not Family Bank in Edmond Oklahoma or something like that), would they be detected? Because, the little reading I’ve done on the super forgeries seems to indicate that they are next to impossible to detect, and ‘next to impossible’ is not a mathematical function. It is not scalar nor vector ...what does ‘next to impossible to detect’ mean? Does it mean that I can exchange the notes with no risk of detection? I’ve traveled a while to Dubai on business at my immediate former job, and I was always wary of receiving large amounts of cash. It must be centers of commerce like Dubai that act as the first stop-over for the notes before they go to the rest of the world.


50 posted on 10/10/2010 10:28:43 AM PDT by spetznaz (Nuclear-tipped Ballistic Missiles: The Ultimate Phallic Symbol)
[ Post Reply | Private Reply | To 45 | View Replies]


Navigation: use the links below to view more comments.
first 1-5051-57 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson