Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

New Tick-Borne Disease Is Discovered
NY Times ^ | September 19, 2011 | DONALD G. McNEIL Jr.

Posted on 09/20/2011 8:51:39 PM PDT by neverdem

A new tick-borne disease that may be stealthily infecting some Americans has been discovered by Yale researchers working with Russian scientists.

The disease is caused by a spirochete bacterium called Borrelia miyamotoi, which is distantly related to Borrelia burgdorferi, the spirochete that causes Lyme disease.

B. miyamotoi has been found — albeit relatively rarely — in the same deer tick species that transmit Lyme, and the Yale researchers estimate that perhaps 3,000 Americans a year pick it up from tick bites, compared with about 25,000 who get Lyme disease.

But there is no diagnostic test for it in this country, so it is not yet known whether it has actually made any Americans sick.

The same short course of antibiotics that normally cures Lyme also seems to cure it.

In Russia, where a team in the Siberian city of Yekaterinburg developed a test that can distinguish miyamotoi from other tick-borne spirochetes, it caused higher fevers than Lyme disease typically does. In about 10 percent of cases, the fevers repeatedly disappear and return after a week or two.

The study by the two teams is to be published soon in the journal Emerging Infectious Diseases. Since the disease was only recently discovered, it is unknown whether it does serious long-term damage, as untreated Lyme disease can.

The Yale medical school researchers — Durland Fish, an entomologist, and Dr. Peter J. Krause, an epidemiologist — have recently won a grant from the National Institutes of Health to study the symptoms and develop a rapid diagnostic kit.

Dr. Fish found B. miyamotoi in American ticks 10 years ago, but was repeatedly refused a study grant until the Russians proved it caused illness. “It’s been like pulling teeth,” he said. “Go ask the N.I.H. why.”

The discovery will no doubt add to the controversy...

(Excerpt) Read more at nytimes.com ...


TOPICS: Culture/Society
KEYWORDS: bmiyamotoi; borrelia; borreliamiyamotoi; deertick; lymedisease; microbiology; nih
Antibodies linked to long-term Lyme symptoms
1 posted on 09/20/2011 8:51:42 PM PDT by neverdem
[ Post Reply | Private Reply | View Replies]

To: neverdem

So shall this new malady be dubbed Lemon-Lyme disease?


2 posted on 09/20/2011 8:58:24 PM PDT by HiTech RedNeck (There's gonna be a Redneck Revolution! (See my freep page) [rednecks come in many colors])
[ Post Reply | Private Reply | To 1 | View Replies]

To: neverdem; DvdMom; grey_whiskers; Ladysmith; Roos_Girl; Silentgypsy; conservative cat; ...

Ping


3 posted on 09/20/2011 9:03:20 PM PDT by decimon
[ Post Reply | Private Reply | To 1 | View Replies]

To: neverdem

4 posted on 09/20/2011 9:06:25 PM PDT by Bean Counter (Obama got mostly Ds and Fs all through college and law school. Keep repeating it.....)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mother Abigail; EBH; vetvetdoug; Smokin' Joe; Global2010; Battle Axe; null and void; ...
micro ping - It's a 17 page PDF with no abstract.

Humans Infected with Relapsing Fever Spirochete Borrelia miyamotoi, Russia

5 posted on 09/20/2011 9:13:24 PM PDT by neverdem (Xin loi minh oi)
[ Post Reply | Private Reply | To 1 | View Replies]

To: neverdem
The journal, Emerging Infectious Diseases, must be a fun read. I would be able to follow the articles only if they made them into Mr. DO and Mr. Don't cartoons. Maybe MR. Don't rolling in the tall weeds might work for the tick diseases.
6 posted on 09/20/2011 9:17:26 PM PDT by dog breath
[ Post Reply | Private Reply | To 1 | View Replies]

To: All; neverdem
But there is no diagnostic test for it in this country, so it is not yet known whether it has actually made any Americans sick.

So there is a diagnostic test somewhere, maybe Russia?

… won a grant from the National Institutes of Health to study the symptoms and develop a rapid diagnostic kit

We need to spend tax dollars making our own test. Seems wasteful.

7 posted on 09/20/2011 9:22:40 PM PDT by newzjunkey (Will racist demagogue Andre Carson be censured by the House?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: neverdem
No mention of how to tell if you've got it, and it's so little known doctors aren't even aware of it yet.

What's a hypochondriac to do?

8 posted on 09/20/2011 9:28:37 PM PDT by Slump Tester (What if I'm pregnant Teddy? Errr-ahh -Calm down Mary Jo, we'll cross that bridge when we come to it)
[ Post Reply | Private Reply | To 1 | View Replies]

To: newzjunkey
So there is a diagnostic test somewhere, maybe Russia?

Maybe they have to culture the bug in special media.

"… won a grant from the National Institutes of Health to study the symptoms and develop a rapid diagnostic kit"

We need to spend tax dollars making our own test. Seems wasteful.

Maybe not, the Russkies are not known for being very generous. Maybe their test is too expensive.

9 posted on 09/20/2011 9:36:50 PM PDT by neverdem (Xin loi minh oi)
[ Post Reply | Private Reply | To 7 | View Replies]

To: neverdem

Ticks: from Albuquerque to yekaterinburg...


10 posted on 09/20/2011 9:37:22 PM PDT by Floyd Rivers
[ Post Reply | Private Reply | To 1 | View Replies]

To: neverdem

Ticks: from Albuquerque to yekaterinburg...


11 posted on 09/20/2011 9:37:41 PM PDT by Floyd Rivers
[ Post Reply | Private Reply | To 1 | View Replies]

To: Slump Tester

Lyme is only one of the diseases spread by ticks. The drs around here can’t recognize tick caused diseases and rarely order tests even when the patient tells of tick bites. They say it isn’t part of their new flow-chart diagnostic routine.

But it will be much better under obamacare.......................


12 posted on 09/20/2011 9:40:00 PM PDT by wrench
[ Post Reply | Private Reply | To 8 | View Replies]

To: neverdem
One of the few good things about fire ants - where you have fire ants you don't have ticks.
13 posted on 09/20/2011 9:48:24 PM PDT by decal (Mother Nature and Real Life are conservatives - the Progs have never figured this out.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: newzjunkey

From the article linked in comment# 5:

“We used improved antibody and PCRs to compare the relative frequency and clinical manifestations of B. miyamotoi infection with those of B. garinii infection in Russia and B. burgdorferi infection in the United States.”

PCR is polymerase chain reaction, a technique for making more copies of genetic material, DNA & RNA.


14 posted on 09/20/2011 9:50:47 PM PDT by neverdem (Xin loi minh oi)
[ Post Reply | Private Reply | To 7 | View Replies]

To: 2ndreconmarine; Fitzcarraldo; Covenantor; Mother Abigail; EBH; Dog Gone; ...

In case you missed this...(Thanks, decimon and neverdem for the pings!)


15 posted on 09/21/2011 11:34:24 AM PDT by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: Smokin' Joe
.(Thanks, decimon and neverdem for the pings!)

If I had pinged you then you would be welcome. ;-)

16 posted on 09/21/2011 1:01:11 PM PDT by decimon
[ Post Reply | Private Reply | To 15 | View Replies]

To: neverdem
Dr. Fish found B. miyamotoi in American ticks 10 years ago, but was repeatedly refused a study grant until the Russians proved it caused illness. “It’s been like pulling teeth,” he said. “Go ask the N.I.H. why.”

Because our government isn't really interested in us being healthy.

17 posted on 09/21/2011 1:46:43 PM PDT by metmom (For freedom Christ has set us free; stand firm therefore & do not submit again to a yoke of slavery)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Smokin' Joe; investigateworld; M. Espinola; Whenifhow; stephenjohnbanker; Liz
Government is out of control. We are living in a police state:

https://www.youtube.com/watch?v=ioN0ehlyyXI&feature=player_embedded

18 posted on 09/21/2011 3:50:30 PM PDT by ex-Texan (Ecclesiastes 5:10 - 20)
[ Post Reply | Private Reply | To 15 | View Replies]

To: Slump Tester

What’s a hypochondriac to do?

If you have a pet or a Viking Kitty, buy a copy of Merck Manual and the kitty will come down with something in every chapter.


19 posted on 09/21/2011 6:04:39 PM PDT by Battle Axe (Repent, for the coming of the Lord is neigh.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Smokin' Joe

Thanks for the ping!


20 posted on 09/21/2011 10:28:14 PM PDT by Alamo-Girl
[ Post Reply | Private Reply | To 15 | View Replies]

To: Alamo-Girl

You’re Welcome, Alamo-Girl!


21 posted on 09/21/2011 10:58:16 PM PDT by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
[ Post Reply | Private Reply | To 20 | View Replies]

To: Swordmaker

spirochete ping


22 posted on 09/22/2011 4:25:02 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: neverdem

from the paper:

Clinical manifestations included fever, headache, chills, fatigue, vomiting, and myalgia.

A single course of ceftriaxone or doxycycline seemed to clear B. miyamotoi infection. Although effective therapy is available, appropriate diagnosis and therapy are complicated by lack of awareness of B. miyamotoi as a human pathogen, the nonspecific symptoms of infection, and the absence of standardized and widely available assays.

B. miyamotoi infection may have negative health consequences, including relapsing disease that may last for months and may not respond to inappropriate antimicrobial drug therapy.


23 posted on 09/22/2011 4:36:02 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5 | View Replies]

To: AdmSmith
spirochete ping

Thanks... Another human infection to chalk up to these very active bacteria. They are a very nasty group of animals.

24 posted on 09/22/2011 2:43:10 PM PDT by Swordmaker (This tag line is a Microsoft product "insult" free zone.)
[ Post Reply | Private Reply | To 22 | View Replies]

To: neverdem

ping again


25 posted on 11/01/2011 11:34:30 AM PDT by vetvetdoug
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson