Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Syria: Sunnis Threatening to Massacre Minority Alawites
Arutz Sheva ^ | 23/12/11 | Elad Benari

Posted on 12/22/2011 3:49:57 PM PST by Eleutheria5

As the civil war in Syria continues and the ethnic tension is rising, the country’s Sunnis are threatening the Alawite minority against their continued support of President Bashar Assad, who is an Alawite himself.

Mamoun al-Homsy, a former Syrian MP and one of the country’s opposition leaders, has reportedly recently distributed a recorded message to the Alawite community in Syria, in which he warns its members against supporting Assad.

In the message, al-Homsy called on the Alawites to immediately renounce Assad, warning them that if they do not do so, “Syria will become the graveyard of the Alawites.”

He also stressed that Syria’s Sunni Muslims “will not remain silent” over Assad’s crimes, adding that they intend to abide by the rule of “an eye for an eye” and will “teach you (Alawites) a lesson that you will not forget.”

Meanwhile, the Lebanese-based As-Safir newspaper has reported that the U.S. government is well aware of the danger of widespread revenge against the Alawite minority in Syria after the expected downfall of the Assad regime.

.....

(Excerpt) Read more at israelnationalnews.com ...


TOPICS: Foreign Affairs; Front Page News; News/Current Events; War on Terror
KEYWORDS: alawites; massacre; sunni; syria
Airdrop some razorbacks over there, too. All of the Middle East would be greatly improved by the deployment of Texas razorbacks. The many crazed muzzies will have to shoot some in self-defense, and if they are starving one another, might be driven to eat the flesh. Then they'll discover that violating the law of the brophet is actually kind of tasty with the right barbecue sauce.
1 posted on 12/22/2011 3:50:07 PM PST by Eleutheria5
[ Post Reply | Private Reply | View Replies]

To: Eleutheria5

It`s a radical islam spring.

This has nothing to do with natural law, the enlightenment, John Locke, etc.

It`s factions of islam fighting for their idea of a caliphate.

Assad is a petty dictator but he is secular mostly and Alawite.


2 posted on 12/22/2011 3:55:21 PM PST by Para-Ord.45 (+)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5
a.k.a. Genocide.

The Middle East is a culture of kto-kogo (to use the Russian phrase). Either you're gettin', or you're gettin' got.

3 posted on 12/22/2011 4:02:21 PM PST by denydenydeny (The more a system is all about equality in theory the more it's an aristocracy in practice.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5
I don't care about the Alawites, Sunnis or Shias. I care only about the hundreds of thousands of Christians in the area, including the Assyrians who fled to Syria after our ill-advised war in Iraq. It's odd that the U.S., a nation with a majority Christian population, feels obligated to protect the Jewish nation of Israel, but shows a disgusting indifference to the genocide being waged against our Christian brethren in the Middle East.

I call on all Christian conservatives to demand that our Presidential candidates take a stand on behalf of Middle Eastern Christians.

4 posted on 12/22/2011 5:00:37 PM PST by hellbender
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5

This is a mistake on the part of the Sunnis, and I’m glad it’s happening. My guess is that those of the Alawites who were fence-sitting will finally make common cause with Assad - as will all non-Sunni or non-Arab minorities. The Assad clan has spent a fair amount of time convincing the Sunni majority that Alawites are Muslims in order to lessen the sting (for Sunnis) of being ruled by an infidel minority, but I suspect this indoctrination never really took, and the following passage from a Daniel Pipes essay explains why:
http://www.danielpipes.org/191/the-alawi-capture-of-power-in-syria


Unveiled women and several other ‘Alawi practices - in particular, that wine drinking is permitted, and that some ceremonies take place at night - long excited Muslim suspicions about ‘Alawi behavior. Then too, the obsessive secrecy inherent to the religion suggested to many Sunnis that the ‘Alawis had something to hide. But what? Over the centuries, the Sunnis’ imaginations supplied a highly evocative answer: sexual abandon and perversion.

Thus, the theologian al-Ash’ari (874-936) held that ‘Alawism encourages male sodomy and incestuous marriages and the founder of the Druze religious doctrine, Hamza ibn ‘Ali (d. 1021), wrote that ‘Alawis consider “the male member entering the female nature to be the emblem of their spiritual doctrine.” Accordingly, ‘Alawi men freely share their wives with co-religionists. These and other accusations survived undiminished through the centuries and even circulated among Europeans. A British traveler of the early 1840s, who was probably repeating local rumors, wrote that “the institution of marriage is unknown. When a young man grows up he buys his wife.” Even ‘Alawis believed in the “conjugal communism” of their religious leaders. Such calumnies remain a mainstay of the anti-’Alawi propaganda circulating in Syria today.

Although the charges are false, ‘Alawis do reject Islam’s sacred law, the Shari’a, and therefore indulge in all manner of activities that Islamic doctrine strictly forbids. ‘Alawis ignore Islamic sanitary practices, dietary restrictions, sexual mores, and religious rituals. Likewise, they pay little attention to the fasting, almsgiving, and pilgrimage ceremonies of Islam ; indeed, they consider the pilgrimage to Mecca a form of idol worship. “Spiritual marriages” between young (male) initiates and their religious mentors probably lie at the root of the charges of homosexuality.

Most striking of all, ‘Alawis have no prayers or places of worship ; indeed they have no religious structures other than tomb shrines. Prayers take place in private houses, usually those of religious leaders. The fourteenth-century traveler Ibn Battuta described how they responded to a government decree ordering the construction of mosques: “Every village built a mosque far from the houses, which the villagers neither enter nor maintain. They often shelter cattle and asses in it. Often a stranger arrives and goes to the mosque to recite the [Islamic] call to prayer; then they yell to him, ‘Stop braying, your fodder is coming.’” Five centuries later another attempt was made to build mosques for the ‘Alawis, this time by the Ottoman authorities; despite official pressure, these were deserted, abandoned even by the religious functionaries, and once again used as barns.

Beyond specific divergences, non-conformity to the Shari’a means that ‘Alawi life follows its own rhythms, fundamentally unlike those of Muslims. ‘Alawis do not act like Sunni Muslims, with only slight differences; rather, they resemble Christians and Jews in pursuing a wholly distinct way of life. Matti Moosa notes that, “like the other extremist Shiites... the Nusayris had total disregard for Muslim religious duties.” Ignaz Goldziher put it succinctly: “This religion is Islam only in appearance.” It is important to make this point very clear: ‘Alawis have never been Muslims and are not now.

Yet, as Ibn Battuta’s account suggests, there is a permanent inconsistency in the ‘Alawi wish to be seen as Muslim. In his case, it was mosques built and then neglected; at other times it is some other half-hearted adoption of Islamic ways. ‘Alawis have a long history of claiming Islam when this suits their needs and ignoring it at other times. In short, like other sects of Shi’i origins, ‘Alawis practice taqiya (religious dissimulation). This might mean, for example, praying side-by-side with Sunni Muslims but silently cursing the Sunni caliphs. The apostate ‘Alawi, Sulayman Efendi al-Adhani, recounted having been sworn to dissimulate about his religion’s mysteries. An ‘Alawi saying explains the sentiment behind taqiya: “We are the body and other sects are but clothing. However a man dresses does not change him. So we remain always Nusayris, even though we externally adopt the practices of our neighbors. Whoever does not dissimulate is a fool, for no intelligent person goes naked in the market.” Another ‘Alawi phrase expresses this sentiment succinctly: “Dissimulation is our righteous war!” (al-kitman jihadna).



5 posted on 12/22/2011 5:44:06 PM PST by Zhang Fei (Let us pray that peace be now restored to the world and that God will preserve it always.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5

According to Pipes, Alawite relations with Sunnis and Shiites alike have been extremely contentious, with Alawites being required to pay the jizya poll tax required of dhimmis and historically having been on the losing end of large scale massacres:
http://www.danielpipes.org/191/the-alawi-capture-of-power-in-syria


Mainstream Muslims, Sunni and Shi’i alike, traditionally disregarded ‘Alawi efforts at dissimulation; they viewed ‘Alawis as beyond the pale of Islam - as non-Muslims. Hamza ibn ‘Ali, who saw the religion’s appeal lying in its perversity, articulated this view: “The first thing that promotes the wicked Nusayri is the fact that all things normally prohibited to humans - murder, stealing, lying, calumny, fornication, pederasty - is permitted to he or she who accepts [’Alawi doctrines].” Abu Hamid al-Ghazali (1058-1111), the Thomas Aquinas of Islam, wrote that the ‘Alawis “apostatize in matters of blood, money, marriage, and butchering, so it is a duty to kill them.”

Ahmad ibn Taymiya (1268-1328), the still highly influential Sunni writer of Syrian origins, wrote in a fatwa (religious decision) that “the Nusayris are more infidel than Jews or Christians, even more infidel than many polytheists. They have done greater harm to the community of Muhammad than have the warring infidels such as the Franks, the Turks, and others. To ignorant Muslims they pretend to be Shi’is, though in reality they do not believe in God or His prophet or His book.” Ibn Taymiya warned of the mischief their enmity can do: “Whenever possible, they spill the blood of Muslims. They are always the worst enemies of the Muslims.” In conclusion, he argued that “war and punishment in accordance with Islamic law against them are among the greatest of pious deeds and the most important obligations” for a Muslim. From the fourteenth century on, Sunnis used the term “Nusayri” to mean pariah.

‘Alawis had had no recognized position in the millet (sectarian) system of the Ottoman Empire. An Ottoman decree from 1571 notes that “ancient custom” required ‘Alawis to pay extra taxes to the authorities and justified this on the grounds that ‘Alawis “neither practice the fast [of Ramadan] nor the ritual prayers, nor do they observe any precepts of the Islamic religion.” Sunnis often saw food produced by ‘Alawis as unclean, and did not eat it. According to Jacques Weulerrse, “no ‘Alawi would dare enter a Muslim mosque. Formerly, not one of their religious leaders was able to go to town on the day of public prayer [Friday] without risk of being stoned. Any public demonstration of the community’s separate identity was taken as a challenge [by the Sunnis].”

Sunnis were not alone in reading ‘Alawis out of Islam-mainstream Shi’is did likewise. And ‘Alawis in turn saw both groups as deficient.

Sunni heresiographers excoriated Alawi beliefs and viewed the Alawis as disbelievers (kuffar) and idolaters (mushrikun). Twelver Shi’i heresiographers were only slightly less vituperative and regarded the Alawis as ghulat, “those who exceed” all bounds in their deification of Ali. The Alawis, in turn, held Twelver Shi’is to be muqassira, “those who fall short” of fathoming Ali’s divinity.

...

The Islamic religion reserves a special hostility for ‘Alawis. Like other post-Islamic sects (such as the Baha’is and Ahmadis), they are seen to contradict the key Islamic tenet that God’s last revelation went to Muhammad, and this Muslims find utterly unacceptable. Islamic law acknowledges the legitimacy of Judaism and Christianity because those religions preceded Islam; accordingly, Jews and Christians may maintain their faiths. But ‘Alawis are denied this privilege. Indeed, the precepts of Islam call for apostates like the ‘Alawis to be sold into slavery or executed. In the nineteenth century, a Sunni shaykh, Ibrahim al-Maghribi, issued a fatwa to the effect that Muslims may freely take ‘Alawi property and lives; and a British traveler records being told, “these Ansayrii, it is better to kill one than to pray a whole day.”

Frequently persecuted-some 20,000 were massacred in 1317 and half that number in 1516, the ‘Alawis insulated themselves geographically from the outside world by staying within their own rural regions.



6 posted on 12/22/2011 5:52:18 PM PST by Zhang Fei (Let us pray that peace be now restored to the world and that God will preserve it always.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; ColdOne; Convert from ECUSA; ...

Okay, but what's the downside? ;') Thanks Eleutheria5.


7 posted on 12/22/2011 5:59:48 PM PST by SunkenCiv (Merry Christmas, Happy New Year! May 2013 be even Happier!)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

Meanwhile the geniuses at the Weekly Standard want to bomb Syria. http://www.weeklystandard.com/blogs/experts-urge-obama-act-syria_613608.html?page=2


8 posted on 12/22/2011 7:48:08 PM PST by rmlew ("Mosques are our barracks, minarets our bayonets, domes our helmets, the believers our soldiers.")
[ Post Reply | Private Reply | To 7 | View Replies]

To: rmlew

:’)


9 posted on 12/22/2011 8:08:15 PM PST by SunkenCiv (Merry Christmas, Happy New Year! May 2013 be even Happier!)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Eleutheria5

If there is high risk for a civil war Turkey will probably intervene.


10 posted on 12/23/2011 1:45:35 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Let them play nice together, and keep the US and Israel the hell out of it (incurpable optimist, I).


11 posted on 12/23/2011 3:53:25 AM PST by Eleutheria5 (Diplomacy is war by other means.)
[ Post Reply | Private Reply | To 10 | View Replies]

To: hellbender

Bravo


12 posted on 12/23/2011 4:52:24 AM PST by junta ("Peace is a racket", testimony from crime boss Barrack Hussein Obama.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: hellbender

I second it as a recovering American, and as a Nouveau-DIB, I call on Israel to make a stand for our natural Middle-Eastern allies, the indigenous Christians of Bethlehem, Egypt, Lebanon, South Sudan..., in short, all those with whom the Islamofascists have a beef, including India and Armenia.


13 posted on 12/23/2011 5:43:00 AM PST by Eleutheria5 (Diplomacy is war by other means.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: hellbender
I don't care about the Alawites, Sunnis or Shias. I care only about the hundreds of thousands of Christians in the area, including the Assyrians who fled to Syria after our ill-advised war in Iraq.

Ultimately, Assad is the last best hope for Christianity in Syria. The primary means for Assad to continue ruling in the face of a rebellious Sunni majority is to kill and drive out (of the country) enough of them that they become a minority. Is that his intent, and if so, will he succeed? We will find out in the weeks and months ahead, in the face of much squawking by the UN and Sunni governments around the world.

14 posted on 12/23/2011 7:19:49 AM PST by Zhang Fei (Let us pray that peace be now restored to the world and that God will preserve it always.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Eleutheria5

they have the asiatic wild hog there already. saw some up in the golan.


15 posted on 12/23/2011 11:12:21 AM PST by RitchieAprile
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5

I think Israel has its hands full defending itself against millions of hate-filled Muslim Arabs. Also, Israel does not have an admirable record in its relations with Middle Eastern Christians, IMO. Israel used the Lebanese Christians as allies, then withdrew from that country, abandoning them.


16 posted on 12/23/2011 2:59:28 PM PST by hellbender
[ Post Reply | Private Reply | To 13 | View Replies]

To: hellbender

“I think Israel has its hands full defending itself against millions of hate-filled Muslim Arabs. Also, Israel does not have an admirable record in its relations with Middle Eastern Christians, IMO. Israel used the Lebanese Christians as allies, then withdrew from that country, abandoning them.”

You are right that Israel’s record is spotty with regards to Lebanese and Bethlehem Christians. But that’s the thing about allies, as opposed to friends. We use each other. And part of the reason we have our hands filled with millions of hate-filled Muslims is that we have not cultivated our regional alliance, instead relying mistakenly on our alliance with the United States, and sacrificing all for the sake of an illusory peace. The peace lies in tatters in the loo, waiting for a PM with the nerve to flush it. But Middle Eastern Christians can use our help, and we can use theirs. We have the same enemies. The Christians are on their rear and flank, and we occupy an inordinate amount of their attention. War is coming. The Islamofascists hate us both. Let’s give them a reason, and work together, the better to utterly defeat them.


17 posted on 12/24/2011 1:17:23 PM PST by Eleutheria5 (Diplomacy is war by other means.)
[ Post Reply | Private Reply | To 16 | View Replies]

To: RitchieAprile

Perhaps a little extra nasty in the gene pool will do some good. Send in the razorbacks.


18 posted on 12/24/2011 1:19:16 PM PST by Eleutheria5 (Diplomacy is war by other means.)
[ Post Reply | Private Reply | To 15 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson