Free Republic
Browse · Search
Topics · Post Article

Skip to comments.

Gut bacteria may affect cardiovascular risk
ScienceNews ^ | December 4, 2012 | Tina Hesman Saey

Posted on 12/10/2012 7:22:13 PM PST by neverdem

Antioxidant-producing microbes may keep atherosclerotic plaques in place

Though atherosclerosis is an artery problem, microscopic denizens of the intestines may play a surprising role in how the disease plays out.

A new study suggests that different mixes of intestinal microbes may determine whether people will have heart attacks or strokes brought on by break-away plaque from the arteries. Compared with healthy people, heart disease patients who have had strokes or other complications of atherosclerosis carry fewer microbes that make anti-inflammatory compounds. These patients also have more bacteria that produce inflammation-triggering molecules, researchers report online December 4 in Nature Communications. Inflammation is thought to promote cardiovascular disease.

The findings may help explain why people with higher levels in their body fat of antioxidant molecules like beta-carotene and lycopene have a lower risk of developing heart disease, but simply feeding people dietary supplements containing the compounds doesn’t help. It may be that a lifelong, intimate association with antioxidant-producing microbes helps some people stave off some of the worst consequences of hardened arteries.

Nearly everyone develops atherosclerosis with age. “We all have it to a certain extent,” says study coauthor Jens Nielsen, a bioinformatician at Chalmers University of Technology in Gothenburg, Sweden.

But some people are more susceptible than others to strokes and heart attacks, even though their arteries are no more blocked than the next person’s, says Fredrik Bäckhed, a microbiologist at the University of Gothenburg who also contributed to the study. The difference stems from the stability of the plaque that builds up inside blood vessels, stiffening and narrowing the vessels. When bits and pieces of plaque break off, they can block the flow of blood to the heart or brain and cause a heart attack or stroke.

Previous research suggests that gut microbes contribute to artery hardening by converting chemicals...

(Excerpt) Read more at ...

TOPICS: Culture/Society; News/Current Events; Testing
KEYWORDS: atherosclerosis; cad; chd; gutbacteria; heartdisease; microbiology; stomachbacteria
Symptomatic atherosclerosis is associated with an altered gut metagenome


1 posted on 12/10/2012 7:22:20 PM PST by neverdem
[ Post Reply | Private Reply | View Replies]

To: neverdem

This is why high flatus producers have long been known to have lower cardiovascular risk. “Beans, beans they’re good for your heart....”

2 posted on 12/10/2012 7:28:12 PM PST by gusopol3
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mother Abigail; EBH; vetvetdoug; Smokin' Joe; Global2010; Battle Axe; null and void; ...
HIV Vector Licks Leukemia

FReepmail me if you want on or off my combined microbiology/immunology ping list.

3 posted on 12/10/2012 7:30:13 PM PST by neverdem ( Xin loi min oi)
[ Post Reply | Private Reply | To 1 | View Replies]

To: neverdem
Atherosclerosis is associated with lipid accumulation and inflammation in the arterial wall,

I had heard a theory years ago that attempted to explain why some people with high levels of cholesterol didn't succumb to heart attacks or stroke and concluded that if you don't have inflammation in the arteries (which attracts the cholesterol and starts to cause a blockage) it dosen't really mater how high your HDL is because as long as it keeps moving through the arteries, it won't stick. Inflammation is the cause of so much disease.

4 posted on 12/10/2012 8:07:57 PM PST by FrdmLvr (culture, language, borders)
[ Post Reply | Private Reply | To 1 | View Replies]

To: gusopol3

I heard Dr. Oz one day tell some women on his show that if they eat beans with every meal it will get rid of inflammation in the stomach area and help them to lose weight. He told them to make chick pea muffins for breakfast if need be.

5 posted on 12/10/2012 8:22:13 PM PST by sheikdetailfeather (Yuri Bezmenov (KGB Defector) - "Kick The Communists Out of Your Govt. & Don't Accept Their Goodies.")
[ Post Reply | Private Reply | To 2 | View Replies]

To: FrdmLvr

There seem to be a number of factors involved.

First, there’s inflammation in the arteries. This attracts cholestorol-carrying LDL particles, Which is what is supposed to happen. (Scar tissue is made up of cholesterol, after all.)

But if some of those LDL particles are large and fluffy, all is well. But if they are small and dense, they can penetrate the arterial wall and get stuck. (Small dense LDL particles are the result of excessive triglycerides, and excess triglycerides are the result of eating more carbs than your body can burn or store.)

Then if those LDLs remain stuck long enough for the fats that they carry to oxidize, you get more inflammation, and an immune response - white blood cells “eat” the LDLs, and die. But then don’t get cleared away, because they’re stuck in the arterial wall. Those dead cells calcify, and that’s the plaque. Interestingly enough, its mostly the poly-unsaturated fats that oxidize. Saturated fats are stable,

And what causes the initial inflammation? Lots of possibilities. High insulin levels (eating too many carbs), stress, lack of sleep, omega 3/omega 6 imbalance, etc. (Omega-3s are used to make anti-inflammatory hormones, omega-6s to make inflammatory hormones. You need both, but you need a balance between them. Oddly enough, grass-fed beef has such a balance. Processed vegetable oils - corn, soy, safflower, peanut, Canola, etc., are almost entirely omega 6.)

So, what is the primary cause of heart disease? Eating too many carbs, and too much polyunsaturated fats.

In other words, following the advice of our government health experts.

6 posted on 12/10/2012 8:30:20 PM PST by jdege
[ Post Reply | Private Reply | To 4 | View Replies]

To: jdege


7 posted on 12/10/2012 8:37:11 PM PST by southland ( party will lead us)
[ Post Reply | Private Reply | To 6 | View Replies]

To: jdege

Now we just need competition and small business in the marketplace...
8 posted on 12/10/2012 10:03:46 PM PST by PieterCasparzen (We have to fix things ourselves)
[ Post Reply | Private Reply | To 6 | View Replies]

To: Winstons Julia


re: sources of inflammation.

9 posted on 12/10/2012 10:13:17 PM PST by PieterCasparzen (We have to fix things ourselves)
[ Post Reply | Private Reply | To 1 | View Replies]

To: jdege

Bingo. Conventional wisdom is killing a lot of people.

10 posted on 12/11/2012 4:03:13 AM PST by GnL
[ Post Reply | Private Reply | To 6 | View Replies]

To: jdege

Well done. The underlying problem is diet, most particularly the eating of carbs. Carb eaters get sick in a variety of ways: diabetes, heart disease, obesity, etc etc. Best to eat high-fat, some protein, vegetables and few carbs.

11 posted on 12/11/2012 6:17:54 AM PST by Blennos
[ Post Reply | Private Reply | To 6 | View Replies]

To: neverdem; SunkenCiv; nuconvert

In a few years time we will drink cocktails consisting of friendly bugs to reduce the risk for various chronic diseases.

12 posted on 12/12/2012 2:33:17 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794 is powered by software copyright 2000-2008 John Robinson