Free Republic
Browse · Search
News/Activism
Topics · Post Article

Symptomatic atherosclerosis is associated with an altered gut metagenome

FReebie

1 posted on 12/10/2012 7:22:20 PM PST by neverdem
[ Post Reply | Private Reply | View Replies ]


To: neverdem

This is why high flatus producers have long been known to have lower cardiovascular risk. “Beans, beans they’re good for your heart....”


2 posted on 12/10/2012 7:28:12 PM PST by gusopol3
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Mother Abigail; EBH; vetvetdoug; Smokin' Joe; Global2010; Battle Axe; null and void; ...
HIV Vector Licks Leukemia

FReepmail me if you want on or off my combined microbiology/immunology ping list.

3 posted on 12/10/2012 7:30:13 PM PST by neverdem ( Xin loi min oi)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: neverdem
Atherosclerosis is associated with lipid accumulation and inflammation in the arterial wall,

I had heard a theory years ago that attempted to explain why some people with high levels of cholesterol didn't succumb to heart attacks or stroke and concluded that if you don't have inflammation in the arteries (which attracts the cholesterol and starts to cause a blockage) it dosen't really mater how high your HDL is because as long as it keeps moving through the arteries, it won't stick. Inflammation is the cause of so much disease.

4 posted on 12/10/2012 8:07:57 PM PST by FrdmLvr (culture, language, borders)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Winstons Julia

ping.

re: sources of inflammation.


9 posted on 12/10/2012 10:13:17 PM PST by PieterCasparzen (We have to fix things ourselves)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: neverdem; SunkenCiv; nuconvert

In a few years time we will drink cocktails consisting of friendly bugs to reduce the risk for various chronic diseases.


12 posted on 12/12/2012 2:33:17 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson