Free Republic
Browse · Search
Topics · Post Article

Skip to comments.

Islamist or Nationalist: Who is Egypt's Mysterious New Pharaoh?
Foreign Policy Research Institute ^ | October 2013 | by Raymond Stock

Posted on 10/20/2013 9:00:19 AM PDT by EternalVigilance

Egypt's new de facto pharaoh, General Abdel-Fattah al-Sisi, is a man of mystery. Is he an Islamist, or a nationalist? Is he a person of high principle, or a lowly opportunist? And in a land which has known five thousand years of mainly centralized, one-man rule, with limited experience of democracy, when have we seen his type before, and where will he lead the troubled, ancient nation now?

These questions are crucial to knowing how the U.S. should react to al-Sisi's removal of Egypt's first "freely elected" president, Mohamed Morsi on July 3 in answer to overwhelmingly massive street protests demanding that he do so, and to the ongoing bloody crackdown on Morsi's group, the Muslim Brotherhood (MB), that began on August 14. Citing the ongoing, actually two-way violence in Egypt, President Barack Obama's administration has now suspended much of our annual $1.6 billion aid to the country, save for money needed to maintain security operations along the Israeli border in Sinai and to directly support the 1979 Egypt-Israel Peace Treaty.

Earlier, the administration had stopped the scheduled delivery of four out of twenty F-16s to Egypt, cancelled the bi-annual "Bright Star" joint training exercises that had been set for September, and launched a review of the bi-lateral relationship. There has now been a delay in paying the final $585 million tranche of this year's aid package, pending that review, according to an October 9 report by the global strategic analysis firm, Stratfor.

However, the administration has been careful not to classify Morsi's removal a "coup," which under U.S. law would require an immediate cut-off of all of our aid to Egypt. That assistance is vital to the U.S.' favored access to the Suez Canal, maintenance of the 1979 Egypt-Israel Peace Treaty and crucial bi-lateral security cooperation against international terrorism. Nonetheless, the latest move puts the entire alliance at great risk, and plays into popular demands that Egypt switch to a more independent stance, or even adopt Russia as chief military supplier instead of the U.S., an idea made more enticing by Washington's apparent weakness in surrendering its interests in Syria to Moscow, and its seeming haste to make concessions to Cairo's post-MB regional antagonist in Tehran over the latter's nuclear program.

Yet along with a number of key Congressional leaders and most of the mainstream media, Obama has been far more critical of al-Sisi and his use of force against a group that our government wrongly supported while in power under the illusion that it was "moderate," than they have been of the violence and mayhem of the MB.

Meanwhile, the MB's "peaceful demonstrators" have been busy burning scores of Christian churches and schools along with hundreds of Christian businesses while attacking other citizens, museums and public buildings, the police and the army, and waging an open war against the state in Sinai and around the country. As the total number of deaths in the past nearly two months of confrontations climbs toward the thousands, the MB clearly hopes to use its own "martyrs" (as both sides call their fallen) to generate sympathy for their unaltered goal of restoring Morsi to power. So far, however, it's not working. Despite a surge in turnout at demonstrations it organized to coincide with the State's grand celebrations of the 40th anniversary of the 1973 war on October 6, fewer and fewer people have been joining its protests, which have been tiny compared to the unprecedentedly-huge demonstrations against the Islamists. THE SECRET THESIS

But what besides the obvious hard realities pushed al-Sisi to act when he did? What does he believe, and what does he want? A quiet man known for saying little and keeping his own counsel, in his year of study at the U.S. Army War College in 2006, al-Sisi produced a research paper or brief thesis on his views of Islam and the state. That document was first exposed by Robert Springborg, an expert on Egypt's military, in a July 28 article in Foreign Affairs.

Springborg predicted that al-Sisi, who has sworn to swiftly restore democracy after a nine-month transition, intends to keep real power for himself. Furthermore, Springborg warned of his "Islamist agenda," saying that he would not likely restore the "secular authoritarianism" practiced by Mubarak, but would install "a hybrid regime that would combine Islamism with militarism." Intriguingly, though it holds no state secrets, the document was classified, and was only released under a Freedom of Information Act request by Judicial Watch on August 8.

In it, al-Sisi declares, "There is hope for democracy in the Middle East over the long term; however, it may not be a model that follows a Western Template" (sic). By that, al-Sisi makes plain, he means that Middle Eastern democracy must be based not on secularism, but on Islam.

However, in an August 16 profile of the previously obscure general published by The Daily Beast by Mike Giglio and Christopher Dickey, those who know al-Sisi (few of whom will talk much about him) say that he grew up in a family that was both religiously conservative—not radical—but extremely nationalistic. And indeed it is that sense of nationalism which seems to have had the upper hand in motivating the actions he's taken thus far.

The chaos, economic calamity, and political upheaval that have rocked Egyptian society since a much more limited popular uprising against longtime president Hosni Mubarak resulted in Mubarak's ouster by the military on February 11, 2011 (at Obama's thinly-veiled urging the night before)—and which led in part to al-Sisi's move against Morsi—have all been seen before. THE RETURN OF GENERAL HOREMHEB?

In 1952, the widespread corruption, resort to political assassination, and the burning of the most elegant parts of downtown Cairo (both of the latter done, it is thought, mainly by the MB) led a group of so-called Free Officers to overthrow Egypt's last king, the feckless Farouk—with covert aid from the U.S.[1]—in a coup, and to declare a republic the next year. Though the move was clandestine and confined to the army, it gained massive popularity and created a mythic hero (who was really an epic failure), Colonel Gamal Abdel-Nasser, the movement's charismatic leader, himself initially a mystery—and to whom al-Sisi is often compared today.

Or perhaps he will be more like Anwar al-Sadat, another Free Officer, who in 1970 succeeded Nasser—the father of one of Egypt's greatest military defeats, in the war of 1967. Sadat partially made up for Nasser's many economic and political blunders by launching a successful surprise attack against Israeli forces in Sinai in 1973 (though it culminated in yet another defeat), partially repealing Nasser's reckless state socialism, trading an alliance with the Soviet Union for one with the United States, and daring to make peace with Israel—though it cost him his life when Islamists shot him down on the anniversary of that "victory" in 1981.

Al-Sisi has rapidly returned to the direct and confident military cooperation with the Jewish State that Morsi reviles, in order to prevent al-Qa'ida-affiliated groups (believed to have cooperated with the Muslim Brotherhood) from staging deadly incidents along the sensitive border.

However, much less reassuringly, al-Sisi has begun to flirt with both Russia and China, and is known to have neither much affection for the U.S., or patience with Obama's pro-MB policy. But going back even further, to 1805, al-Sisi could turn out to be like Mohamed Ali Pasha—Farouk's first direct royal forebear, an Albanian-Kurdish mercenary who used popular discontent against Egypt's oppressive Ottoman governor to replace him in office.

Mohamed Ali would briefly revive Egypt's long-lost military glory, and more relevantly, would do so by breaking with his own patrons in Istanbul--a possible cautionary tale for Washington now. And yet, plumbing much more deeply the currents of Egyptian history, al-Sisi may really most resemble Horemheb, the last king of the fabled 18th Dynasty.

Horemheb served as head of the army under Akhenaten (ruled 1353-1336 B.C.), the "heretic king" who became the first ruler of any country to embrace something close to monotheism, a fanatic who threw out the traditional pantheon of ancient Egyptian gods in favor of worship of the Aten, the disc of the sun. Akhenaten's navel-gazing neglect of the nation's economy and security while he persecuted the believers of other deities and—like Morsi—inserted his own followers everywhere in the bureaucracy, led to massive unrest and perhaps prompted his most trusted lieutenant, Horemheb, to overthrow him—though his exact fate is unknown.

Born a commoner, Horemheb did not seize the throne until its last royal claimant, Tutankhamun, had died—as well as the boy-king's aged tutor Ay, who had married his widow. But when he did take it, he promptly stamped out the hated Aten cult and brought back that of the suppressed Amun-Ra, leading to a century of initially strong and stable rule by people mainly bearing the name of his successor and military protégé, a man called Ramesses.

As a soldier, Horemheb was no doubt angry that Akhenaten allowed Egypt's hard-won empire in the Near East to largely slip away without a fight. The nation's sacred prestige fell for the first time in centuries, and had to be reestablished so that ma'at—meaning everything from truth to order to righteousness, bound up with Egypt's well-being--could reign once again. And that he quickly set out to do.

Here is a degree of parallel with al-Sisi, who reportedly had been enraged by Morsi's actions that led not only to a loss of Egypt's international prestige but also damaged her national sovereignty. This he saw not only in Morsi's apparent covert cooperation with militants who had killed and kidnapped many Egyptian troops in Sinai, but also in his release of numerous terrorists convicted of murdering their fellow Egyptians plus members of the army, police and foreign tourists. Two symbolic acts by Morsi also not only raised eyebrows, but a sense of alarm about his intentions.

The first was Morsi's decision not only to invite Tarek al-Zomor, a member of the terrorist organization, al-Gama'a al-Islamiya (the Islamic Group), who took part in the assassination of President Anwar al-Sadat on the eighth anniversary of his 1973 brief but psychologically crucial triumph over Israel in Sinai, but to place him in the front row during the commemoration of the day on October 6 last year. The second was Morsi's June 2013 appointment of Adel Mohamed al-Khayat, a leader of al-Gama'a al-Islamiya, which waged a civil war against the Mubarak regime in the 1990s, killing scores of foreign tourists as well as hundreds of security officials, politicians and Egyptian civilians, to be governor of Luxor—where its most violent attack killed 58 foreigners and four Egyptian police and tourist guides (who died trying to defend the others) in November 1997.

Moreover, in late June this year, Morsi threatened to declare jihad on the embattled Bashar al-Assad regime in Syria in which the military had no interest. Al-Sisi was similarly piqued that Morsi allowed some in his cabinet to make threats to attack a controversial dam in Ethiopia that it is feared will lessen Egypt's accustomed share of the Nile's vital waters. And he was reportedly appalled that Morsi had evidently even told Sudan's Islamist president, Omar Bashir, whom the U.N. has accused of genocide in Darfur, that he would consider giving that country land which lies in dispute between them on their common border.

To Egyptians since antiquity, to yield any part of the nation's territory is an unforgivable heresy. "BUT I LOVED EGYPT MORE."

Perhaps worst of all, the MB calls for the establishment of a new caliphate, and lately demanded that its capital be in Jerusalem, which would not only mean a war to the death with Israel for which Egypt is not prepared, but—if successful--would obliterate the nation's independence. Misr al-Mahrusa—"God-Guarded Egypt," an ancient epithet for the country--would be no more.

Though the general wrote nostalgically in his U.S. War College paper of the caliphate that united the Islamic world for seventy years after the death of the Prophet Muhammad in 632, he stated as well that only extremists were calling for its immediate return now. And if it does come back, he would undoubtedly want it to be based in Cairo.

Adding to all this was Morsi's rapid and relentless attempt to turn Egypt into a one-party Islamist dictatorship, and how it had destroyed both tourism and foreign investment while turning formerly rather small, if persistent protests by scattered secularist groups in an historically pious society into the largest demonstrations the world had ever seen.

On October 8, The Washington Post ran an AP story that quoted the first of a three part interview of al-Sisi by the respected Egyptian daily, AlMasryAlYoum, in which the general-turned-king breaker recounts for the first time what led to his actions on July 3:

El-Sissi said the turmoil of the past three months could have been avoided if Morsi had resigned in the face of the protests that drew out millions against him, starting on June 30. Days after the protests began, el-Sissi said, he met with senior Brotherhood figures, including the group's strongman Khairat el-Shater.

He said el-Shater warned him that the Brotherhood, which made up the backbone of Morsi's administration, would not be able to control retaliation by Islamic groups in Sinai and other areas if Morsi were removed.

"El-Shater spoke for 45 minutes, vowing terrorist attacks, violence, killings by the Islamic groups," el-Sissi told the paper. "El-Shater pointed with his finger as if he is shooting a gun."

He said el-Shater's speech "showed arrogance and tyranny," adding: "I exploded and said ... 'What do you want? You either want to rule us or kill us?"

Addressing Islamists now in the wake of Morsi's fall, el-Sissi said, "Watch out while dealing with Egyptians. You have dealt with Egyptians as if you are right and they are wrong ... (as if) you are the believer and they are the infidels. This is arrogance through faith."

In the first part of the interview published Monday, el-Sissi said he told Morsi in February, "your project has ended and the amount of antipathy in Egyptians' souls has exceeded any other regime." He added that the military's move against Morsi was driven by fears of civil war.

Given all this, could it be any wonder that the highly-patriotic, if also pious general with whom Morsi had replaced the aged Mubarak holdover Mohamed Hussein Tantawi because of his seemingly solid Islamist credentials had—after long hesitation—eventually felt that he had to act for the sake of his country? Ironically, al-Sisi was born and raised in the old Islamic quarter of Cairo called Gamaliya, the native district of Egypt and the Arab world's first (and so far only) Nobel laureate in literature, Naguib Mahfouz (1911-2006).

Mahfouz, despite a very strict Islamic upbringing, was from his youth a pharaonist—someone who placed Egypt's unique national heritage above anything else, including Islam, in defining her identity—as well as his own. One of Mahfouz's most prescient works is his peculiar 1983 novel-in-dialogue, Before the Throne. In it he hauls about three score of the nation's rulers--from Menes in the First Dynasty to al-Sadat—before the Osiris Court, the divine tribunal which in ancient Egyptian belief judged the souls of the dead. Before the Throne features many cycles of tyranny, rebellion, chaos and restoration, which presage the events of the past three years in uncanny ways.

In the afterlife trial of Horemheb, there is an exchange between the general who turned on Akhenaten and the addled religious zealot himself that could well have taken place between al-Sisi and Morsi, though without the intense mutual affection, no doubt:

"I loved none of my followers more than you, Horemheb," Akhenaten reproached him. "Nor was I as generous with anyone as much as I was with you. My reward was that you betrayed me…"

"I deny nothing you have said," replied Horemheb. "I loved you more than any man I'd ever known—but I loved Egypt more."

(This writer has explored this novel's uncanny relationship to the overthrow of Mubarak in a May 2011 E-Note, "Egypt's Revolution Foreseen in Fiction: Before the Throne by Naguib Mahfouz.")

Time will tell if al-Sisi, currently calling the shots behind an all-secularist civilian government of technocrats of his choosing, is truly more nationalist than Islamist—whether he will restore ma'at or shari'a (Islamic law)—and if he will guide Egypt back into stability (or fails to do so) as a democrat in uniform, or as a martinet behind a "democratic" curtain. A key clue will be if he pushes for a new Constitution that omits the central problem with the one rammed through by Morsi, which not only made shari'a the main source of legislation (as it was before)—but which also empowered the clerics of al-Azhar, the highest authority in Sunni Islam, to interpret all laws to ensure compliance with it.

A draft of the new Constitution, released on August 21, would reinstate the Mubarak-era ban on religious parties, throw out the most offensive aspects of Morsi's Islamist Constitution from the point of view of religious tolerance, and ban the formation of religious parties—a very good sign. The fifty-member commission (headed by former Arab League chief and presidential candidate, Amr Moussa), that is now reworking the draft, in coordination with the panel of experts that produced it, may entirely rewrite the Morsi-era charter.

The only Islamist group to join the body and to play any part in the transition, the Salafi al-Nour Party, has protested against the removal of the shari'a provision—but the secularists, including the commission's spokesman, head of the Arab Writers' Union Mohamed Salmawy, seem to control the process so far. However, the August 21 draft specifically outlawed the removal of the president by popular protest, reserving that right for parliament (the lower house of which has been dissolved due to violations of elections laws since June 2012)—to the outrage of the activists who fought to bring down both Mubarak and Morsi.

A recent decree replaces the oath that members of the armed forces formerly took to the nation's president, Constitution and laws with a declaration of loyalty solely to the country's military leadership. As the experience not only of Egypt both before and under the Brotherhood, but also Pakistan under its own generals, Gaza under Hamas and even Turkey under the more stealthily Islamist Recep Tayyip Erdogan has shown, only a separation of mosque and state with civilian control of the military can deliver anything like real democracy.

In Egypt, arguably the most religion-obsessed country on earth all through her world's-longest history (and one of the most authoritarian as well), we should not expect to see either genuine democracy or even its prerequisite, a strong degree of secularism, with or without the new Constitution—or al-Sisi himself--anytime soon.

Yet at least Egypt will not be ruled by the MB—which threatens not only the world's oldest nation, but us all--thanks to this enigmatic character from the heart of Old Cairo:General Abdel-Fattah al-Sisi.

Raymond Stock, a Shillman-Ginsburg Writing Fellow at the Middle East Forum and a former Assistant Professor of Arabic and Middle East Studies at Drew University, spent twenty years in Egypt, and was deported by the Mubarak regime in 2010.

[1] See Matthew F. Holland, America and Egypt: From Roosevelt to Eisenhower (Westport, CT: Praeger, 1996), pp. 25-26.

TOPICS: Egypt; Foreign Affairs; Israel; US: Pennsylvania; War on Terror
KEYWORDS: abdelfattahalsisi; alsisi; egypt; egyptcoup; fatimanaoot; israel; jerryrubin; pennsylvania; ramonstock; raymondstock; raystock

1 posted on 10/20/2013 9:00:19 AM PDT by EternalVigilance
[ Post Reply | Private Reply | View Replies]

To: EternalVigilance

King Tut.... buried in his jammies!

2 posted on 10/20/2013 9:03:48 AM PDT by Pining_4_TX (All those who were appointed to eternal life believed. Acts 13:48)
[ Post Reply | Private Reply | To 1 | View Replies]

To: EternalVigilance

Sisi may be very good indeed, and in any case infinitely better than Obama’s Brotherhood.

3 posted on 10/20/2013 9:06:10 AM PDT by Hardraade (
[ Post Reply | Private Reply | To 1 | View Replies]

To: Hardraade

Time will tell.

4 posted on 10/20/2013 9:25:57 AM PDT by EternalVigilance (I'm not a Democrat. I'm not a Republican. I'm a Christian and an American.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: Pining_4_TX
King Tut.... buried in his jammies!

The first reports of King Tut's DNA was that he was Irish.

5 posted on 10/20/2013 9:54:04 AM PDT by mountainlion (Live well for those that did not make it back.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: EternalVigilance

translation: the Egyptian military was unable to come to agreements, behind the scenes, with the Muslim Brotherhood, that would preserve its national and institutional perogatives and privileges, including a seat-of-power of its own in the national government and in certain national decisions; and so now it is trying to reach that agreement with a few of the Islamists groups outside of the Muslim Brotherhood; so that like the Saudi princes, a pact is made to be made that divides areas of secular power between Islamist clerics and those who control and run the military and “internal security”; of course, part of that pact will be the military top dogs will have to “speak Islamist”, no matter how they live their personal lives - appearances and public support for fundamentalist religious positions must be kept

the question is, what will the moderates and secular Muslims who helped the military unseat Morsi do now

6 posted on 10/20/2013 11:04:26 AM PDT by Wuli
[ Post Reply | Private Reply | To 1 | View Replies]

To: EternalVigilance

Ineresting; A comparison thriugh the Foreign Policy Research Institute’s Raymond Stock of a Egyptian political figure who’s group seems to be out of favor with the administration to a long forgotten Pharaoh. Particularly since the new government was denied a scheduled arms shipment and responded with a warning “it’s a mistake”.

7 posted on 10/20/2013 11:36:30 AM PDT by mosesdapoet (Serious contribution pause.Please continue onto meaningless venting no one reads.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...

Thanks EternalVigilance.
Raymond Stock, a Shillman-Ginsburg Writing Fellow at the Middle East Forum and a former Assistant Professor of Arabic and Middle East Studies at Drew University, spent twenty years in Egypt, and was deported by the Mubarak regime in 2010.
Oh, yeah, this author used to live around here, and earlier yet, was associated with Jerry Rubin.

8 posted on 10/21/2013 7:22:59 PM PDT by SunkenCiv (It's no coincidence that some "conservatives" echo the hard left.)
[ Post Reply | Private Reply | View Replies]

Rand Slams Congress for Funding Egypt’s Generals:
‘How Does Your Conscience Feel Now?’
Foreign Policy | 15 Aug 2013 | John Hudson
Posted on 08/15/2013 5:44:10 PM PDT by Hoodat

Sen. Rand Paul is hammering his fellow senators for keeping billions in financial aid flowing to Egypt’s military — even as Cairo’s security forces massacre anti-government activists.

[by “anti-government activists” is meant church-burning jihadists]

9 posted on 10/21/2013 7:25:26 PM PDT by SunkenCiv (It's no coincidence that some "conservatives" echo the hard left.)
[ Post Reply | Private Reply | View Replies]

To: EternalVigilance; SunkenCiv; nuconvert; gandalftb

What is his take on this:

Egyptian Poet Fatima Naoot: Egypt Was Conquered by the Arabs, Coptic Language Changed By Force

10 posted on 10/22/2013 10:34:12 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv


I knew nothing about the author when I posted this. Just seemed interesting and informative.

11 posted on 10/22/2013 11:04:23 AM PDT by EternalVigilance
[ Post Reply | Private Reply | To 8 | View Replies]

To: AdmSmith

(six months later) thanks, interesting.

12 posted on 04/25/2014 5:43:08 PM PDT by SunkenCiv (
[ Post Reply | Private Reply | To 10 | View Replies]

Second source. And wow, that joker “interviewing” her was an illogical bigot.

13 posted on 04/25/2014 5:47:50 PM PDT by SunkenCiv (
[ Post Reply | Private Reply | To 10 | View Replies]

a bigoted childish rant against her:

14 posted on 04/25/2014 5:50:34 PM PDT by SunkenCiv (
[ Post Reply | Private Reply | To 10 | View Replies]

To: SunkenCiv

She is active on Twitter (in Arabic) mainly about poetry and women’s rights. I would say that she is a brave person.

15 posted on 04/25/2014 10:59:37 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794 is powered by software copyright 2000-2008 John Robinson