Free Republic
Browse · Search
Topics · Post Article

Skip to comments.

Al Gore: Keystone an ‘atrocity’ ^ | October 24, 2013 | ANDREW RESTUCCIA

Posted on 10/24/2013 9:14:05 PM PDT by Tailgunner Joe

A fiery Al Gore urged President Barack Obama on Thursday to reject the Keystone XL oil pipeline, calling the controversial project an “atrocity.”

“This should be vetoed. It is an atrocity. It is a threat to our future,” the former vice president said during a Center for American Progress 10th anniversary event in Washington.

Gore criticized the Canadian oil sands that the pipeline would carry, arguing that approval of the project would be akin to a desperate drug addict looking for fresh veins.

“Junkies find veins in their toes when the ones in their arms and legs give out,” said Gore, a vocal climate advocate who has previously used the drug addiction metaphor to describe Keystone. “We are now at the point where we’re going after these ridiculously dirty and dangerous carbon-based fuels. And we’ve got to stop that.”

Gore delighted the progressive crowd at the CAP event, listing off a bevy of facts and figures about the threat of climate change.

“You think I’m passionate about this? You’re damn right I’m passionate about this,” said Gore, who got a standing ovation. “I do love this country, damn it. And our country is in very deep trouble.”

Gore lamented the broad “dysfunction” in Capitol Hill. “It’s pathetic,” he said.

Earlier in the event, Carol Browner, Obama’s former top climate change adviser, said she thinks the president will ultimately reject Keystone.

“I think at the end of the day he will say no, but there will be some twists and turns before we get there,” Browner said.

Browner served as Obama’s climate and energy adviser until 2011, when she left the administration and later joined CAP as a senior fellow. She previously served as EPA administrator during Bill Clinton’s administration.

She did not elaborate on her remarks about the pipeline.

Secretary of State John Kerry, who also spoke at the CAP event, will ultimately have to decide whether the Alberta-to-Texas pipeline would meet the U.S. national interest. He did not mention the pipeline during his speech, but he touted the economic promise of investments in energy.

“Energy policy is the solution to global climate change,” Kerry said during his remarks.

The State Department is expected to soon unveil a final environmental analysis of the pipeline, although the department’s final judgment about the national interest is not expected for at least several months.

Approval of the project seemed almost inevitable at one point, especially after former Secretary of State Hillary Clinton once suggested she was “inclined” to approve the project. A March State Department draft analysis said Keystone would have little environmental impact.

But in recent months, Obama has said the project can’t go forward if it would “significantly” increase greenhouse gas emissions, and he has hinted that Canada could do more to make the pipeline environmentally acceptable. He has also scoffed at Keystone supporters’ job-creation estimates and raised the possibility that Keystone could raise gasoline prices.

Some Republicans — like Rep. Ed Whitfield (R-Ky.), a top GOP lawmaker on the House Energy and Commerce Committee — have said they don’t believe Obama will approve the pipeline.

Earlier in her remarks, Browner gave the administration a good grade for its work on climate change and said the president has done all he can to address the issue in the face of resistance from Congress. She also touted the administration’s efforts to tighten fuel economy standards, improve energy efficiency and expand renewables.

Browner added that she has “confidence” in current EPA Administrator Gina McCarthy, who she said has one advantage that Browner lacked during her time at the agency: McCarthy doesn’t have to argue with the White House about whether to tackle climate change, as Browner said she did under Clinton.

“Gina McCarthy doesn’t have to go over to the White House and argue whether or not she’s going to regulate greenhouse gases,” she said. “She only has to argue about the degree.”

Browner also expressed confidence that the EPA will be able to complete its work on climate change regulations before Obama leaves office. She said she believes Obama’s climate action plan, which he unveiled during a speech this summer, was written to ensure that the administration has enough time to complete the rules.

“They started from the last day in office and worked backwards to make sure it’s completely done,” she said.

TOPICS: Canada; News/Current Events
KEYWORDS: algore; aljazeera; canada; carbontax; carolbrowner; currenttv; energy; epa; jazeeraalgore; kenyanbornmuzzie; opec
Al Gore: ‘Congress is pathetic right now’ - October 24, 2013 - “Some of the same people who stood up with a straight face, said it would be perfectly fine for the United States of the America to default on it’s debt and lose it’s good credit and denying the reality of creditworthiness. … But they’re the same people who’ve been saying that the laws of physics don’t apply and that … pollution does not cause global warming, and that Mother Nature is not sending a us a signal with all of these extreme weather catastrophes that the scientists are telling us are definitely connected to the climate crisis.”
1 posted on 10/24/2013 9:14:05 PM PDT by Tailgunner Joe
[ Post Reply | Private Reply | View Replies]

To: Tailgunner Joe

who’s al gore?

2 posted on 10/24/2013 9:17:24 PM PDT by lurk
[ Post Reply | Private Reply | To 1 | View Replies]

To: lurk


3 posted on 10/24/2013 9:20:12 PM PDT by bigheadfred
[ Post Reply | Private Reply | To 2 | View Replies]

To: lurk
who’s al gore?

Wasn't he that bug eyed freak who assisted Gene Wilder?

4 posted on 10/24/2013 9:27:46 PM PDT by Mark17 (Chicago Blackhawks: Stanley Cup champions 2010, 2013. Vietnam Veteran, 70-71)
[ Post Reply | Private Reply | To 2 | View Replies]

To: lurk

“who’s al gore?”
He is the king of Atrocity, and an embarrassment to my former home, the great state of Tennessee.

5 posted on 10/24/2013 9:29:41 PM PDT by AlexW
[ Post Reply | Private Reply | To 2 | View Replies]

To: Tailgunner Joe

No, sex poodle - YOU are the atrocity. Lying bloviating SOS.

6 posted on 10/24/2013 9:29:42 PM PDT by beethovenfan (If Islam is the solution, the "problem" must be freedom.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe
Pipeline atrocities currently in existence in the USA. This map should be shown to anyone wondering about this keystone pipeline. Notice the Alaska one. When it was being proposed back in the 1970s environuts were predicting the caribou would be traumatized. They tended to like the pipeline since it was a source of heat.

7 posted on 10/24/2013 9:33:09 PM PDT by xp38
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

“This should be vetoed. It is an atrocity. It is a threat to our future,” the former vice president said during a Center for American Progress 10th anniversary event in Washington. “

It’s amazing that a man this insane could be so wealthy.

8 posted on 10/24/2013 9:37:32 PM PDT by headstamp 2 (What would Scooby do?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

“Gore criticized the Canadian oil sands that the pipeline would carry, arguing that approval of the project would be akin to a desperate drug addict looking for fresh veins.”

Hey Al, either they sell the oil to us or it goes to China.


9 posted on 10/24/2013 9:38:34 PM PDT by headstamp 2 (What would Scooby do?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

“Secretary of State John Kerry, who also spoke at the CAP event, will ultimately have to decide whether the Alberta-to-Texas pipeline would meet the U.S. national interest.”

God help us with the fools in government.

10 posted on 10/24/2013 9:39:40 PM PDT by headstamp 2 (What would Scooby do?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mark17
Yes master...
11 posted on 10/24/2013 9:40:26 PM PDT by EEGator
[ Post Reply | Private Reply | To 4 | View Replies]

To: EEGator

Yeah, that freak.

12 posted on 10/24/2013 9:50:29 PM PDT by Mark17 (Chicago Blackhawks: Stanley Cup champions 2010, 2013. Vietnam Veteran, 70-71)
[ Post Reply | Private Reply | To 11 | View Replies]

To: Tailgunner Joe

God please take home manbearpig

13 posted on 10/24/2013 10:05:04 PM PDT by Hoosier-Daddy ( "It is not our job to protect the people from the consequences of their political choices.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

Shut up Al! Your enviroscam is old news. Nobody is buying your garbage anymore. We’re busy with communist medicine and the foreign invasion of America right now. Get a job or a hobby and we’ll get back to you when we want to laugh at your wacky antics again.

14 posted on 10/24/2013 10:09:27 PM PDT by FlingWingFlyer (ObamaCare should have been tested on politicians before being released to the public!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: xp38

Every where you look on the Bakken there is a new pipeline going in

15 posted on 10/24/2013 10:22:24 PM PDT by South Dakota (shut up and build a bakken pipe line)
[ Post Reply | Private Reply | To 7 | View Replies]

To: Tailgunner Joe

When Gore first got into the global warming scam, it was political expediency, a way to wrap up the environmental kook vote. A know-nothing, science illiterate, who barely scraped through freshman courses in college had someone write a book for him, and he suddenly became a climate guru. He invested himself so deeply into climate fraud he can’t get out, like a Hollywood movie about a cop who goes so far undercover he loses himself in the character. Imagine, Algore’s real self must suck worse than the character he plays.

16 posted on 10/24/2013 10:43:54 PM PDT by pallis
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

Good old Bone-head ... running his mouth again!

17 posted on 10/24/2013 11:04:49 PM PDT by Zakeet (Democrats haven't destroyed your freedoms ... you can still visit them at the Smithsonian)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

Gore would get a much better understanding of what an atrocity really looks like if he would just glance in a mirror.

18 posted on 10/25/2013 12:19:23 AM PDT by clearcarbon
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe; All

The two biggest threats to the development of US and Canada based energy development are the two biggest threats to any American development...Global Warming Hoaxsters and Free Traders.

Al Gore is both...and many Dems and GOP are Both

19 posted on 10/25/2013 1:00:47 AM PDT by SeminoleCounty (Fact Is: GOPe want ObamaCare.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe
Then he got back on his corporate Gulfstream V, which burns Gaea knows how many gallons per hour of kerosene and went back to one of his five mansions.
20 posted on 10/25/2013 2:49:30 AM PDT by 2ndDivisionVet (Ted Cruz/Sarah Palin 2016)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

I don’t know what infuriates me more: That this gasbag, as a wealthy politician who has probably never wanted for anything his whole life, has the nerve to lecture folks like me on what we need when we’re struggling to make ends meet...or that he can do this and people don’t get as enraged as I am.

21 posted on 10/25/2013 4:27:32 AM PDT by RWB Patriot ("My ability is a value that must be purchased and I don't recognize anyone's need as a claim on me.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: clearcarbon

He can’t; they shatter whenever he so much as glances at one.

22 posted on 10/25/2013 4:29:58 AM PDT by RWB Patriot ("My ability is a value that must be purchased and I don't recognize anyone's need as a claim on me.")
[ Post Reply | Private Reply | To 18 | View Replies]

To: Tailgunner Joe

Oh, shut up al, and go play with your chakra.

23 posted on 10/25/2013 5:49:52 AM PDT by ken in texas
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...

Thanks Tailgunner Joe.

How the U.S. Shale Boom Is Splitting OPEC Apart

24 posted on 11/03/2013 7:43:55 PM PST by SunkenCiv (
[ Post Reply | Private Reply | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...

thanks Tailgunner Joe.

Al Gore, raising the heat on Obama, calls Keystone an “atrocity”

25 posted on 11/03/2013 7:55:22 PM PST by SunkenCiv (
[ Post Reply | Private Reply | View Replies]

from the FRchives:
26 posted on 11/03/2013 8:39:08 PM PST by SunkenCiv (
[ Post Reply | Private Reply | View Replies]

To: Tailgunner Joe

The reason the Keystone pipeline won’t get approval is that the Saudies don’t want it. They have had obama on a leash since he was young. He can’t take a shit unless they give him a kee to the can.

27 posted on 11/04/2013 12:46:19 AM PST by Octar
[ Post Reply | Private Reply | To 1 | View Replies]

To: Octar; Tailgunner Joe

Pehaps the train lobby is at work:

28 posted on 11/04/2013 2:24:48 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 27 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794 is powered by software copyright 2000-2008 John Robinson