Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

In the long run, wars make us safer and richer
Washington Post ^ | April 25, 2014 | By Ian Morris

Posted on 04/26/2014 9:34:04 PM PDT by Brad from Tennessee

Norman Angell, the Paris editor of Britain’s Daily Mail, was a man who expected to be listened to. Yet even he was astonished by the success of his book “The Great Illusion,” in which he announced that war had put itself out of business. “The day for progress by force has passed,” he explained. From now on, “it will be progress by ideas or not at all.”

He wrote these words in 1910. One politician after another lined up to praise the book. Four years later, the same men started World War I. By 1918, they had killed 15 million people; by 1945, the death toll from two world wars had passed 100 million and a nuclear arms race had begun. In 1983, U.S. war games suggested that an all-out battle with the Soviet Union would kill a billion people — at the time, one human in five — in the first few weeks. And today, a century after the beginning of the Great War, civil war is raging in Syria, tanks are massing on Ukraine’s borders and a fight against terrorism seems to have no end.

So yes, war is hell — but have you considered the alternatives? When looking upon the long run of history, it becomes clear that through 10,000 years of conflict, humanity has created larger, more organized societies that have greatly reduced the risk that their members will die violently. These better organized societies also have created the conditions for higher living standards and economic growth. War has not only made us safer, but richer, too. . .

(Excerpt) Read more at washingtonpost.com ...


TOPICS: Editorial
KEYWORDS: firstworldwar; war
Navigation: use the links below to view more comments.
first 1-5051-80 next last
Ian Morris, a professor of classics at Stanford University, is the author of “War! What is it Good For? Conflict and the Progress of Civilization from Primates to Robots.”
1 posted on 04/26/2014 9:34:04 PM PDT by Brad from Tennessee
[ Post Reply | Private Reply | View Replies]

To: Brad from Tennessee

WWI was a good thing. What a fool.


2 posted on 04/26/2014 9:36:39 PM PDT by DManA
[ Post Reply | Private Reply | To 1 | View Replies]

To: Brad from Tennessee

humm: progress through war (or let’s just say human conflict of varied types).

that strikes me as another very good encapsulation of leftist (progressive) ideology and practice.


3 posted on 04/26/2014 9:46:12 PM PDT by dadfly
[ Post Reply | Private Reply | To 1 | View Replies]

To: DManA

Very arguably, everything we see today is the result of WWI.


4 posted on 04/26/2014 9:48:04 PM PDT by DesertRhino (I was standing with a rifle, waiting for soviet paratroopers, but communists just ran for office.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Brad from Tennessee
A delightfully contrarian point of view, although I'm not sure it's intended to be taken entirely seriously. One can always find a point of view whereby war is an advantage, but it's usually by shifting one's perspective to that of the winner.

What we have here is a perspective that shifts from the broad view to the narrow one when it suits the argument. Government is not always preferable to chaos, especially when it's trying to put your carcass into an oven for the Greater Good. Whether that beats a no-government situation in which a marauding barbarian puts a spear into your guts is one of those fine points I won't explore overmuch. Either way, you lose.

What does work is the empowerment of the individual to guard himself and his against both scenarios. If, to do so, he must make war, then once again we have shifted our perspective to the advantage of the fight. I'd offer a slight corrective: apparently we can't avoid it, so we might as well be good at it. That doesn't necessarily extend to celebrating it.

5 posted on 04/26/2014 9:49:34 PM PDT by Billthedrill
[ Post Reply | Private Reply | To 1 | View Replies]

To: Brad from Tennessee

I’d like to be safer.

Can we nuke Mecca, Cairo, Jakarta, Karachi and Ankara please?


6 posted on 04/26/2014 9:50:31 PM PDT by BenLurkin (This is not a statement of fact. It is either opinion or satire; or both.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Brad from Tennessee
So yes, war is hell — but have you considered the alternatives?

Yes. War created the United States - an absolute positive for the world in the last 200 years. War ended slavery in the US. War ended the subjugation of Europe and the extermination of the Jews and Gypsies by the Nazis. War has ended genocide in Bangladesh and in the former Yugoslavia since then. War is sometimes necessary for the long-term good of the human race - and those who willfully blind themselves to that fact don't do the human race any favors.
7 posted on 04/26/2014 9:50:51 PM PDT by AnotherUnixGeek
[ Post Reply | Private Reply | To 1 | View Replies]

To: Brad from Tennessee

Wow, this is a thinly veiled attack on Ronald Reagan.


8 posted on 04/26/2014 9:51:17 PM PDT by nickcarraway
[ Post Reply | Private Reply | To 1 | View Replies]

To: DesertRhino

I know. If you could go back in time who would you kill?

Hitler or Wilson?

Hard choice.


9 posted on 04/26/2014 9:51:30 PM PDT by DManA
[ Post Reply | Private Reply | To 4 | View Replies]

To: DesertRhino

Can somebody please go back in time and kill Karl Marx’s parents before they meet?


10 posted on 04/26/2014 9:52:45 PM PDT by BenLurkin (This is not a statement of fact. It is either opinion or satire; or both.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Brad from Tennessee; Cicero
When looking upon the long run of history, it becomes clear that through 10,000 years of conflict, humanity has created larger, more organized societies that have greatly reduced the risk that their members will die violently.

This is the logical fallacy, post hoc, ergo propter hoc. The author fails to adduce evidence that the larger, more organized societies would not have been created without the violent conflicts he deems to have been necessary.

11 posted on 04/26/2014 9:53:22 PM PDT by aposiopetic
[ Post Reply | Private Reply | To 1 | View Replies]

To: DesertRhino
Very arguably, everything we see today is the result of WWI

Agreed. However, I would posit, not that arguable.
12 posted on 04/26/2014 9:58:00 PM PDT by 98ZJ USMC
[ Post Reply | Private Reply | To 4 | View Replies]

To: DManA
I know. If you could go back in time who would you kill Hitler or Wilson?

Neither would be necessary, if you wasted that poor slob Gavarilo Princip.
13 posted on 04/26/2014 10:02:43 PM PDT by 98ZJ USMC
[ Post Reply | Private Reply | To 9 | View Replies]

To: 98ZJ USMC

I don’t know about that. The poor fools were just itching for a fight.


14 posted on 04/26/2014 10:14:46 PM PDT by DManA
[ Post Reply | Private Reply | To 13 | View Replies]

To: DManA

Yes, I agree, The mentally unstable Kaiser with the withered arm was going to cause a conflagration in any case, and a reason would have been found for war.


15 posted on 04/26/2014 10:21:19 PM PDT by Bobalu (What cannot be programmed cannot be physics)
[ Post Reply | Private Reply | To 14 | View Replies]

To: BenLurkin

Don’t forget that damned well in Qom!


16 posted on 04/26/2014 10:22:37 PM PDT by null and void ( They don't think think they are above the law. They think they are the law.)
[ Post Reply | Private Reply | To 6 | View Replies]

To: DManA
I know. If you could go back in time who would you kill?

Mohammed.

17 posted on 04/26/2014 10:23:20 PM PDT by null and void ( They don't think think they are above the law. They think they are the law.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: AnotherUnixGeek

War didn’t create the United States, war largely enslaved Europe until Reagan freed it. Slavery was probably on it’s way out without war.

There are more slaves today than at any other time supposedly.


18 posted on 04/26/2014 10:24:49 PM PDT by ansel12 ((Libertarianism offers the transitory concepts and dialogue to move from conservatism, to liberalism)
[ Post Reply | Private Reply | To 7 | View Replies]

To: Brad from Tennessee

In the 20th century some 200+ million people were killed by their own governments, not in wars, so I’m not sure about the claim that modern people are safer.


19 posted on 04/26/2014 10:27:33 PM PDT by TigersEye (Stupid is a Progressive disease.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Brad from Tennessee

He’s a bean counter and it’s true that certain types of wars have a bottom line to them. People like him can reason the human suffering away, while those suffering can’t.


20 posted on 04/26/2014 10:46:46 PM PDT by Usagi_yo
[ Post Reply | Private Reply | To 1 | View Replies]

To: null and void

Good choice.


21 posted on 04/26/2014 10:55:14 PM PDT by Carry_Okie (The tree of liberty needs a rope.)
[ Post Reply | Private Reply | To 17 | View Replies]

To: null and void

He’s Time Travel Target One.


22 posted on 04/27/2014 12:40:30 AM PDT by samtheman
[ Post Reply | Private Reply | To 17 | View Replies]

To: Bobalu

The French also wanted revenge for the Franco-Prussian war where they got trounced by Germany. All major European powers had big interests. WWI may have been stupid, but like many wars stopping it from happening given the circumstances would have been mighty difficult. Wars up that point were not something foreign to European states.


23 posted on 04/27/2014 1:34:14 AM PDT by driftless2
[ Post Reply | Private Reply | To 15 | View Replies]

To: Brad from Tennessee

“War! What is it Good For?”

http://www.youtube.com/watch?v=01-2pNCZiNk


24 posted on 04/27/2014 3:14:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Brad from Tennessee

War is indeed the mother of civilization. Small hunter-gatherer bands were constantly in conflict. Early agricultural settlements were constantly feuding with the tribe over the hill, across the river, or in the next glen. The death toll from constant raids and skirmishes was extremely high. Leadership in such societies was usually a duopoly between the elders, thought to be wise, and the battle leaders. People eventually formed larger state to improve their chances of winning wars. States grew because they won wars.


25 posted on 04/27/2014 3:23:33 AM PDT by sphinx
[ Post Reply | Private Reply | To 1 | View Replies]

To: DesertRhino; DManA
WWI was a good thing. What a fool.

It resulted in the deaths of millions of men, the destruction of billions of dollars of property and billions of dollars of lost production, the rise of Lenin and subsequently of Stalin, the rise of world communism as a force in history for the first time, the rise of Hitler, the formation of the failed League of Nations and its bastard step child the UN, and a dozen other horrible consequences that I can't even think of at this time of the day.

Very arguably, everything we see today is the result of WWI.

For the record, I agree with you, as is obvious from the above.

26 posted on 04/27/2014 4:17:32 AM PDT by Hardastarboard (Please excuse the potholes in this tagline. Social programs have to take priority in our funding.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: DManA
WWI was a good thing. What a fool.

Perhaps the question might be, "When others use force to take over neighboring countries and to expand their own power base, what are the available options and what should be the limiting factors for a response?".

After all, it's only a "war" if there is resistance; else it's just a one-sided killing and subjugation.

27 posted on 04/27/2014 4:18:16 AM PDT by trebb (Where in the the hell has my country gone?)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Brad from Tennessee

it becomes clear that through 10,000 years of conflict, humanity has created larger, more organized societies that have greatly reduced the risk that their members will die violently. “

Yep when the Communists rolled into Russia, Cuba, China, when the NAZI’s stood astride Germany and then a good deal of Europe EVERYONE breathed a sigh of relief and said “Cool, now we can live!”


28 posted on 04/27/2014 4:23:10 AM PDT by TalBlack (Evil doesn't have a day job.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Brad from Tennessee

war is a Darwinian mechanism that sorts out the weak and the strong.

The Germans bent on gaining territory and thus population were at bottom line intent on expanding their gene pool. ditto the Japanese.

Hitler erred...... he took on Russia and the result was a genetic dilution from death and raped women. His gambit failed miserably. The aggressive German population was and is subdued by genes. The long occupation altered the population genetic make up.

an interesting factor was the introduction of America into the mix. The American culture prevailed even though there was not much rape, there was gene swapping as a result of the influx.

Putin needs population and Russian genes to shore up his failing gene pool. Mother Russia is severely ailing


29 posted on 04/27/2014 4:35:34 AM PDT by bert ((K.E. N.P. N.C. +12 ..... History is a process, not an event)
[ Post Reply | Private Reply | To 1 | View Replies]

To: null and void

This thread is over.


30 posted on 04/27/2014 4:36:54 AM PDT by FreedomPoster (Islam delenda est)
[ Post Reply | Private Reply | To 17 | View Replies]

To: Brad from Tennessee
What a pantload! Wars have not made us safer and richer. Defeating tyrannical governments in wars have made us safer and richer. You do not need to read far between the lines and Ian Morris admits as much.
31 posted on 04/27/2014 4:38:49 AM PDT by Vigilanteman (Obama: Fake black man. Fake Messiah. Fake American. How many fakes can you fit in one Zer0?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Brad from Tennessee

Tell it to the Carthaginians, or a dozen other peoples annihilated by neighboring empires. The winners right the history books, and conclude that “It was worth it.” Anyone who thinks the Great War was worth it is an idiot.


32 posted on 04/27/2014 4:39:07 AM PDT by Lonesome in Massachussets (This is known as "bad luck". - Robert A. Heinlein)
[ Post Reply | Private Reply | To 1 | View Replies]

To: DManA

Old Brooklyn Dodgers’ fans joke: Imagine you are in a room with Hitler, Stalin and Walter O’Malley, and have a gun with two bullets. What do you do?

Shoot O’Malley twice.


33 posted on 04/27/2014 4:42:07 AM PDT by Lonesome in Massachussets (This is known as "bad luck". - Robert A. Heinlein)
[ Post Reply | Private Reply | To 9 | View Replies]

To: dadfly; Lonesome in Massachussets; Brad from Tennessee; Vigilanteman; FreedomPoster; bert; ...
Reagan’s great fear — that bloated government would stifle individual freedom — shows just how far the continuing debates over the merits of big and small government have taken us from the horrors that worried Hobbes.

“The 10 most dangerous words in the English language,” Reagan said on another occasion, “are ‘Hi, I’m from the government, and I’m here to help.’ ”

As Hobbes could have told him, in reality the 10 scariest words are, “There is no government and I’m here to kill you.”

Well Hobbes had his point; we do need a government large enough to protect us from the dregs of society that would kill us and take our stuff.

However we do not want what we are seeing more and more of today; a government that comes to us and says give me your stuff or I will jail you.

So what Reagan said was true and another way Reagan could have said it was. “The 11 most dangerous words in the English language, are “Hi, I’m from the government, and I’m here to Kill you.”

Government is often either too large or too small and the tendency is to grow too large. Those in power almost always desire more power and therefore constantly push for more power.

I don’t think anyone on this thread has read the article in its intirety or understands the author’s point.

What the author is trying to point out is that wars lead to larger states that control the murderous inclinations of men and tribes. Before there were Nation States there were City States that were frequently at war with one another (read your Old Testament). Through war city states formed nation states which gave us broader areas of peace.

Great periods of human advancement occurred after periods of prolonged expansion of great powers for example Pax Romana and Pax Britannia.

The author’s larger point is that the world needs a country large enough and powerful enough (economically, politically and militarily) to enforce international trade rules and enforce a modicum of world peace.

First there was Rome then there was Great Britain and finally there was the United States. Unfortunately expanding socialism has nearly neutered the United States. And possibly the final nail in our coffin may be driven by a president that views the US as an evil colonial power that must be subdued for the sake of impoverished third world nations that are taken advantage of by the US.

Another point the author makes is that the great powers that enforce free trade inevitably build up the subject nations by trading with them.

All of these things suggest that war over the long view have been beneficial by expanding the geographical size of governments and freeing trade among people.

34 posted on 04/27/2014 6:23:06 AM PDT by Pontiac (The welfare state must fail because it is contrary to human nature and diminishes the human spirit.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: DesertRhino; BenLurkin; USMC; Hardastarboard; cripplecreek
Very arguably, everything we see today is the result of WWI.

I Disagree.

It is a FACT that everything we see today is the result of World War I

Look at the AFTERMATH of the war!

November 11th didn't stop the fighting. Essicpally in the East. Did you know the U.S. Occupied Parts of Austria after the war? I didn't.

The First World War was the great "Revolutionary Holocaust" that Marxists had been waiting for 70 years.

All it took was 10's of Millions being killed and they got what they wanted.

They Bagged the Largest Nation on Earth into a Communist Government. Bagged all of Central Asia under it too.

Briefly Set Up Soviet Republics in Hungary, Bavaria and Alsace-Loraine.

It's actually kind of mind boggling.

http://en.wikipedia.org/wiki/Aftermath_of_World_War_I

35 posted on 04/27/2014 6:36:36 AM PDT by KC_Lion (Build the America you want to live in at your address, and keep looking up.- Sarah Palin)
[ Post Reply | Private Reply | To 4 | View Replies]

To: KC_Lion
The First World War was the great "Revolutionary Holocaust" that Marxists had been waiting for 70 years.

Not to mention descending on the wealthiest nation in Europe (Germany) like vultures and impoverishing them after the war.
36 posted on 04/27/2014 6:54:56 AM PDT by cripplecreek (REMEMBER THE RIVER RAISIN!)
[ Post Reply | Private Reply | To 35 | View Replies]

To: Pontiac

Thanks, a good point. Still, coming from the Washington Post, it appears that the false dichotomy being presented is between Attila and Obama.


37 posted on 04/27/2014 7:32:09 AM PDT by Lonesome in Massachussets (This is known as "bad luck". - Robert A. Heinlein)
[ Post Reply | Private Reply | To 34 | View Replies]

To: Brad from Tennessee

All he is saaaying, is give war a chance.


38 posted on 04/27/2014 7:50:52 AM PDT by luvbach1 (We are finished. It will just take a while before everyone realizes it.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Lonesome in Massachussets

No argument from me.


39 posted on 04/27/2014 8:36:12 AM PDT by Pontiac (The welfare state must fail because it is contrary to human nature and diminishes the human spirit.)
[ Post Reply | Private Reply | To 37 | View Replies]

To: Pontiac

“And possibly the final nail in our coffin may be driven by a president that views the US as an evil colonial power that must be subdued for the sake of impoverished third world nations that are taken advantage of by the US.”

Or there will be a war and the obozo side will lose;).


40 posted on 04/27/2014 9:05:57 AM PDT by TalBlack (Evil doesn't have a day job.)
[ Post Reply | Private Reply | To 34 | View Replies]

To: Brad from Tennessee

We get richer indirectly about 20 years later as a result of the massive investment in “cutting edge” technologies done under threat of death. A cold war is by far the best war of all. This communication is brought to you indirectly by the Cold War invention of the Advanced Research Projects Agency Network (ARPANET). The internet boom started about 20 years after its implementation. Currently DARPA is investing heavily in robotics. 20 years from now you will own several general purpose robots... and probably have no job.


41 posted on 04/27/2014 9:17:56 AM PDT by Reeses
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pontiac
So what Reagan said was true and another way Reagan could have said it was. “The 11 most dangerous words in the English language, are “Hi, I’m from the government, and I’m here to Kill you.”

Minor point of order. It's seldom an individual that does all that killing, it's usually a vast bureaucracy, a conspiracy of paper pushers and appeasers who do the thousands of little mundane details that insure that everything ins in place, all the t's are crossed, the i's dotted, the trains move the victims to the right camps, the showers have enough Zyklon, the front lines have beans and bullets, all the right forms, and all the right people live and the wrong ones die. It's the neighbors who under government orders watch and report, who never dare interfere, the teachers and preachers who assure their charges that this is all right and proper, just as they were told, or else.

No. The most dangerous words aren't: "Hi, I’m from the government, and I’m here to Kill you.”

They are: “Hi, we're from the government, and we're here to kill you.”

42 posted on 04/27/2014 9:21:59 AM PDT by null and void ( They don't think think they are above the law. They think they are the law.)
[ Post Reply | Private Reply | To 34 | View Replies]

To: null and void
No. The most dangerous words aren't: "Hi, I’m from the government, and I’m here to Kill you.”

They are: “Hi, we're from the government, and we're here to kill you.”

Excellent point

I stand corrected.

Most of the minions of totalitarians do not have the courage to act alone.

43 posted on 04/27/2014 9:29:44 AM PDT by Pontiac (The welfare state must fail because it is contrary to human nature and diminishes the human spirit.)
[ Post Reply | Private Reply | To 42 | View Replies]

To: Brad from Tennessee
Extremely small government meant there was at least some law and order; no government meant that there was not.

While government in moderation is a very good thing, more is not better. The benefit curve forms an arc. We are clearly on the downward slope right now. The source of much conflict is that people living in high density communes called cities need more government while people living in America need less. Leftists believe one size fits all for government intrusion and centralized planning, but that is clearly not the case.

44 posted on 04/27/2014 9:35:28 AM PDT by Reeses
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pontiac

Nor the imagination to connect their signature on a death warrant form with the demise of an actual human being.


45 posted on 04/27/2014 9:40:08 AM PDT by null and void ( They don't think think they are above the law. They think they are the law.)
[ Post Reply | Private Reply | To 43 | View Replies]

To: null and void
Nor the imagination to connect their signature on a death warrant form with the demise of an actual human being.

Well in a sense you may be right.

Usually the mind set of these people (the true believers) is that they dehumanized the victims in their minds as vermin not deserving of life.

Some of them are merely government workers who decide it is either the victim or themselves and their families. They do the math in their head and decide that their lives are worth more. They know that they are sending someone to their death but do not have the courage to say no.

46 posted on 04/27/2014 9:55:20 AM PDT by Pontiac (The welfare state must fail because it is contrary to human nature and diminishes the human spirit.)
[ Post Reply | Private Reply | To 45 | View Replies]

To: Pontiac
Unfortunately expanding socialism has nearly neutered the United States.

Massive social welfare spending and exorbitant taxes on the productive members of society also did in the Roman Empire, even though it had an advantage the US does not have in the wealth it extracted from it's conquered territories.
47 posted on 04/27/2014 10:45:02 AM PDT by AnotherUnixGeek
[ Post Reply | Private Reply | To 34 | View Replies]

To: Pontiac

I understood the author’s point. I just disagree with it.


48 posted on 04/27/2014 12:40:12 PM PDT by TigersEye (Stupid is a Progressive disease.)
[ Post Reply | Private Reply | To 34 | View Replies]

To: DManA; BillyBoy; fieldmarshaldj; GOPsterinMA; NFHale; Clintonfatigued; Bender2; AuH2ORepublican; ...
I know. If you could go back in time who would you kill?

Hitler or Wilson?

Hard choice.

Not for me. According to all time travel fiction, any attempt to go back in time and kill Hitler will either end up causing his birth (Terminator paradox) or leading to the Nazis winning the war somehow.

Rather than killing Wilson though I would kill TR, thus preventing Wilson's election in 1912, which would probably prevent US entry into WW1, which would have meant a more favorable peace for Germany, which probably would have averted WW2, which would mean a lot more German and Austrian guys named Adolf. Adolf Schwarzenegger perhaps?

49 posted on 04/27/2014 6:23:05 PM PDT by Impy (RED=COMMUNIST, NOT REPUBLICAN)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Impy; DManA

As was said above, Gavrilo Princip would’ve been the one to take out. No World War I meant no WW2, Hitler as a housepainter in Vienna with no influence...

Besides, it was Theodore Roosevelt’s selfishness that brought Wilson to the White House. A party unified behind President Taft could not have made Wilson’s win possible.


50 posted on 04/27/2014 6:29:20 PM PDT by fieldmarshaldj (Resist We Much)
[ Post Reply | Private Reply | To 49 | View Replies]


Navigation: use the links below to view more comments.
first 1-5051-80 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson