Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russia said it moved its troops away from Ukraine. Satellite images seem to say otherwise.
WP ^ | May 9, 2014 | Adam Taylor and Gene Thorp

Posted on 05/10/2014 10:29:25 AM PDT by 1rudeboy

Earlier this week there was a rare sign of rapprochement in Ukraine's ongoing crisis, with Russian President Vladimir Putin suggesting his country's military had pulled back from its troubled neighbor's borders.

"We were told repeatedly that our forces by the Ukrainian border were a source of concern," Putin said on Wednesday. "We have withdrawn our forces and they are now not on the Ukrainian border but are carrying out their regular exercises at the test grounds."

The announcement was welcomed: The sheer scale of Russian troops on the borders had been a real cause of concern. But some United States officials were quick to voice skepticism.

(Excerpt) Read more at washingtonpost.com ...


TOPICS: Extended News; Foreign Affairs; News/Current Events; Russia
KEYWORDS:

1 posted on 05/10/2014 10:29:25 AM PDT by 1rudeboy
[ Post Reply | Private Reply | View Replies]

To: 1rudeboy

So there’s something both Putin & Obama have in common...they’re both liars.


2 posted on 05/10/2014 10:33:47 AM PDT by O6ret
[ Post Reply | Private Reply | To 1 | View Replies]

To: 1rudeboy

Sounds like they permanently relocated their “test grounds” south and west. And while not “on the border” they are a short morning’s drive from it.


3 posted on 05/10/2014 10:34:15 AM PDT by Mariner (War Criminal #18)
[ Post Reply | Private Reply | To 1 | View Replies]

To: O6ret

And one’s an amateur. And it ain’t Putin.


4 posted on 05/10/2014 10:34:45 AM PDT by 1rudeboy
[ Post Reply | Private Reply | To 2 | View Replies]

To: 1rudeboy

Don’t watch the movement of ground troops at this point, but watch the movement of AICRAFT....

The Russians recently reopened a couple of abandoned airbases in the south, and have been moving assets there.

If Putin is following the Obama/Clinton Libya/Kosovo guide, which I have said several times that I think he is, that will be the thing to watch.


5 posted on 05/10/2014 10:54:51 AM PDT by tcrlaf (Q)
[ Post Reply | Private Reply | To 1 | View Replies]

To: tcrlaf
Obama/Clinton Libya/Kosovo guide

Why bother with that? We have the 2008 Georgia Edition of the guide. [snort]

6 posted on 05/10/2014 11:07:18 AM PDT by 1rudeboy
[ Post Reply | Private Reply | To 5 | View Replies]

To: 1rudeboy

Who are you going to believe, Putin or your lying eyes?


7 posted on 05/10/2014 11:44:50 AM PDT by Agog
[ Post Reply | Private Reply | To 1 | View Replies]

To: 1rudeboy; SunkenCiv; gandalftb; Agog

The did not move their troops, but they moved their money:

The European Central Bank says capital flight from Russia since the Ukraine crisis erupted may be four times higher than admitted by the Kremlin, a clear sign that sanctions pressure is inflicting serious damage on the Russian economy.

http://www.telegraph.co.uk/finance/financialcrisis/10817511/ECB-capital-flight-from-Russia-has-hit-220bn.html


8 posted on 05/10/2014 1:45:53 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson