Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

30-year New York Times Science Writer Out After Writing Book About Genetics, Race
Daily Caller ^ | 5/10/2014 | Chris Reed

Posted on 05/11/2014 10:16:48 AM PDT by mojito

Nicholas Wade, a British-born science reporter and editor for more than 30 years with The New York Times, is no longer with the newspaper — just days after the release of his latest book, in which he depicts blacks with roots in sub-Saharan Africa as genetically less adapted to modern life than whites and Asians.

Was The New York Times uncomfortable with Wade’s science or his conclusions? It’s unclear. Neither Wade nor his former employer returned requests for comment.

Wade’s last Times article appeared April 24. His Penguin Press book “A Troublesome Inheritance: Genes, Race and Human History” arrived in bookstores on Tuesday, May 6. In excerpts from his book posted by on Friday, he is identified as a “former science editor” of the Times. Until then, coverage of his book called him a current Times journalist.

Wade’s main thesis is that “human evolution has been recent, copious and regional.” He writes, “Though there is still a large random element, the broad general theme of human history is that each race has developed the institutions appropriate to secure survival in its particular environment.”

(Excerpt) Read more at ...

KEYWORDS: africa; amnesty; blacks; brazil; china; doublestandard; europe; genetics; germany; godsgravesglyphs; groupthink; helixmakemineadouble; immigration; india; japan; mexico; neandertal; neandertals; neanderthal; neanderthals; newyorkslimes; newyorktimes; nicholaswade; obama; pages; racism; racist; richardlewontin; russia; stephenjaygould
Navigation: use the links below to view more comments.
first 1-5051-66 next last
When liberals are against science, it's ok, because sometimes science is bad.
1 posted on 05/11/2014 10:16:48 AM PDT by mojito
[ Post Reply | Private Reply | View Replies]

To: mojito

some science is more equal than another.

2 posted on 05/11/2014 10:19:29 AM PDT by going hot (Happiness is a momma deuce)
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito

Science is what we say it is, comrade.

3 posted on 05/11/2014 10:19:41 AM PDT by 98ZJ USMC
[ Post Reply | Private Reply | To 1 | View Replies]

To: All

he could not have been all that bright if he thought he was going to get away with it.

4 posted on 05/11/2014 10:20:13 AM PDT by willywill
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito

Liberals use science when it suits them. They also attempt to portray scientists are some sort of mystic elders who are infallible and virtuous, covering up their more unpleasant conclusions such as this. Liberals will run to climate scientists who say global warming is real, but will quietly shrug when you mention that the real place you’ll find theories of racial supremacy in America is not rural Mississippi, but the lecture halls of top universities.

Never forget, Margaret Sanger, who libs also love.

5 posted on 05/11/2014 10:20:28 AM PDT by Viennacon
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito
The New Goebbels Times
6 posted on 05/11/2014 10:22:02 AM PDT by tomkat
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito
This report might not be true. Wade's Wikipedia entry was changed to reflect his firing, with a citation to the Daily Caller article, but was changed again earlier today to state that he is currently with the Times. His publisher's website still shows him as writing for the Times, as does Amazon. I can't find any source for this story except the Daily Caller, and their only basis for this announcement seems to be the fact that TIME referred to him as a former writer for the Times, which could just be an error by TIME.

Also, I'm told by someone who knows Wade that he is not a Times employee but is a semi-retired contributor of occasional pieces. So, they really can't "fire" him, although they can stop publishing his stuff.

So, I would take this with a grain of salt until we learn more.

7 posted on 05/11/2014 10:25:18 AM PDT by jumpingcholla34
[ Post Reply | Private Reply | To 1 | View Replies]

To: jumpingcholla34

Thanks for that background report. Good to know.

8 posted on 05/11/2014 10:29:34 AM PDT by mojito (Zero, our Nero.)
[ Post Reply | Private Reply | To 7 | View Replies]

To: mojito

Leftists attack Christians as “not scientific”, but when the science gores their own ox, they kill the messenger. Remember “The Bell Curve”?

9 posted on 05/11/2014 10:32:20 AM PDT by ozzymandus
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito

If the facts contradict what is politically correct, the facts be damned.

10 posted on 05/11/2014 10:32:28 AM PDT by goldstategop (In Memory Of A Dearly Beloved Friend Who Lives In My Heart Forever)
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito

Forget evolution. Think about how the characteristics of domestic animal breeds can be changed in a single decade through selective cross-breeding. The problem with the whole topic, however, is that - at present - it’s a true dismal science (unlike economics, which is neither truly dismal nor a science). There’s not much that can be done about a person’s essential characteristics once he’s born. Calvin was right, but with genes being the mechanism of divinely-ordained determinism.

11 posted on 05/11/2014 10:42:55 AM PDT by Zhang Fei (Let us pray that peace be now restored to the world and that God will preserve it always.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito

Based on their reactions on discussion threads about the book, there are several Freepers who fire him too.

12 posted on 05/11/2014 10:43:46 AM PDT by Balding_Eagle (Want to keep your doctor? Remove your Democrat Senator.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: goldstategop


I don’t know exactly what his research showed, or what his precise conclusions are. But I DO know that he violated political correctness.

As we’re talking about sub-Saharan Africa, we need to know the politically correct view. The politically correct view as to why so many countries there are hell holes, is due to the vestiges of colonialism.

We are not supposed to talk about the fact that many of these countries are rich in natural resources, and have fertile farmland, and question why they are in such trouble.

We are not supposed to talk about how racism is not a factor, because some of these countries have almost all black populations, and black leaders. Instead, we are supposed to blame colonialism for all of their problems.

13 posted on 05/11/2014 10:45:25 AM PDT by Dilbert San Diego
[ Post Reply | Private Reply | To 10 | View Replies]

To: mojito

So is it correct to say he’s been “Derbyshired”—or has he been “National Reveiwed”?

14 posted on 05/11/2014 10:45:34 AM PDT by 9YearLurker
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito

I guess we can only have a ‘frank discussion on race’ if we get permission from the PC police first.

15 posted on 05/11/2014 10:45:36 AM PDT by fhayek
[ Post Reply | Private Reply | To 1 | View Replies]

To: Balding_Eagle


Like the thread I had the poor judgement to post on till 530 am

16 posted on 05/11/2014 10:46:01 AM PDT by wardaddy (we will not take back our way of life through peaceful means.....i have 5 kids....i fear for them)
[ Post Reply | Private Reply | To 12 | View Replies]

To: mojito

All the news that fits we'll print.

They're usually a bit slyer than this, so it could be a fake. Sounds about right, though.
17 posted on 05/11/2014 10:48:57 AM PDT by caveat emptor (!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito

Must silence those we disagree with. Wonder if they would get violent to do so?

18 posted on 05/11/2014 10:51:35 AM PDT by Altura Ct.
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito

Who knew we had NYT editors here..

19 posted on 05/11/2014 10:52:23 AM PDT by wardaddy (we will not take back our way of life through peaceful means.....i have 5 kids....i fear for them)
[ Post Reply | Private Reply | To 1 | View Replies]

To: 9YearLurker
So is it correct to say he’s been “Derbyshired”?

It's not just the "liberal media" that enforces our national groupthink on race.

20 posted on 05/11/2014 10:57:24 AM PDT by mojito (Zero, our Nero.)
[ Post Reply | Private Reply | To 14 | View Replies]

To: willywill

I would tend more to think that, after thirty years and the Derbyshire and Richwine incidents, he would know the potential consequences but not care. He of all people would know how the PC police of the left operate.

21 posted on 05/11/2014 10:58:34 AM PDT by mrsmel (One Who Can See)
[ Post Reply | Private Reply | To 4 | View Replies]

To: mojito

“Science”: the consensus of the anointed.

22 posted on 05/11/2014 10:59:19 AM PDT by Theophilus (.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: willywill

I suspect that after 30 years, he expects a full Bell Curve treatment but doesn’t give a damn. NBA team ownership is definitely not in his future.

23 posted on 05/11/2014 11:01:22 AM PDT by Chewbarkah
[ Post Reply | Private Reply | To 4 | View Replies]

To: jumpingcholla34

Good fact checking.

24 posted on 05/11/2014 11:02:28 AM PDT by 9YearLurker
[ Post Reply | Private Reply | To 7 | View Replies]

To: mojito

If the NYT thinks this fellow’s book deserves censoring, I can hardly wait to see how they react to the books written by that super-rich elitist 1%-er Charles Darwin.

25 posted on 05/11/2014 11:04:32 AM PDT by LearsFool ("Thou shouldst not have been old, till thou hadst been wise.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito
Some numbers to ponder...

Countries with the Highest / Lowest Average IQ
26 posted on 05/11/2014 11:10:54 AM PDT by SpaceBar
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito
. . . one way or another, “A Troublesome Inheritance” will be historic. Its proper reception would mean enduring fame as the book that marked a turning point in social scientists’ willingness to explore the way the world really works. But there is a depressing alternative: that social scientists will continue to predict planetary movements using Ptolemaic equations, as it were, and that their refusal to come to grips with “A Troublesome Inheritance” will be seen a century from now as proof of this era’s intellectual corruption. - Charles Murray on Nicholas Wade’s “A Troublesome Inheritance”

27 posted on 05/11/2014 11:12:02 AM PDT by conservatism_IS_compassion (The idea around which “liberalism" coheres is that NOTHING actually matters except PR.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito
Jay-Z says that the black man is god.

And He said: “Take heed that you not be deceived. For many will come in My name, saying, ‘I am He,’ and, ‘The time has drawn near.’ Therefore do not go after them." - Luke 21:8

28 posted on 05/11/2014 11:12:20 AM PDT by Dr. Thorne ("How long, O Lord, holy and true?" - Rev. 6:10)
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito

I thought the science was settled.

29 posted on 05/11/2014 11:14:30 AM PDT by Tanniker Smith (Rome didn't fall in a day, either.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito

30 posted on 05/11/2014 11:14:48 AM PDT by Altura Ct.
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito

Progressives worship Darwin. They indeed find blacks inferior and incapable of caring for themselves. Evolution has turned man in to nothing but a mindless souless animal according to progressives. Of course when challenged their thought SWAT teams jump to action.

31 posted on 05/11/2014 11:17:20 AM PDT by Organic Panic
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei; mojito

I don’t believe anyone raises an argument when it is pointed out that people who have lived at high altitudes (Andes, Himalayas) over generations developed a tolerance for low oxygen levels, or those who have lived in malarial environments developed red blood cells with the sickle cell trait (see as a protective advantage.

32 posted on 05/11/2014 11:25:42 AM PDT by thecodont
[ Post Reply | Private Reply | To 11 | View Replies]

To: mojito
blacks with roots in sub-Saharan Africa as genetically less adapted to modern life than whites and Asians.

Coincidentally, sub-Saharan Africans are the only group with no Neanderthal genealogy.

33 posted on 05/11/2014 12:37:21 PM PDT by The Sons of Liberty ("Our brethren are already in the field! Why stand we here idle?" - Patrick Henry, 1775)
[ Post Reply | Private Reply | To 1 | View Replies]

To: thecodont
I don’t believe anyone raises an argument when it is pointed out that people who have lived at high altitudes (Andes, Himalayas) over generations developed a tolerance for low oxygen levels, or those who have lived in malarial environments developed red blood cells with the sickle cell trait.

Some people think that species grow wings after they're born or something. In reality, strains with useful characteristics for a given environment outbreed those that don't. But there are limits imposed by given form factors. Humans can't survive on a cockroach's calorie intake. Humans can't breathe under water. Tibetans who had no tolerance for high altitudes presumably either left for the lowlands outside of Tibet or died (young) of altitude sickness. In time, the only people left in Tibet were those who had that tolerance, as altitude-tolerant couples begat altitude-tolerant children.

34 posted on 05/11/2014 3:07:30 PM PDT by Zhang Fei (Let us pray that peace be now restored to the world and that God will preserve it always.)
[ Post Reply | Private Reply | To 32 | View Replies]

To: mojito

All the news that fits our belief system.

Science is objective, impartial, and a guide to the truth of the world beyond superstition and prejudice: determining something before studying the facts - except when it doesn’t support what we’re saying. Then it’s hateful and unreliable.

35 posted on 05/11/2014 3:45:52 PM PDT by OldNewYork
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito
I don't know what young Freepers think about race, but fifty years ago, it was "settled science" that there was no such thing as race. All groups of people were the same physically and mentally. The blank slate i.e. tabula rasa theory of intelligence was the dominant mode of thought for those in the know. You only knew what society taught you. Nobody had inherited intelligence. And despite people descended from west Africa dominating the sprints in track and field and many major sports, there was no difference in inherited physical ability.

The blank slate theory has been thoroughly debunked by a number of researchers as was the equally loony theory that all the people of the world have the same physical properties. In short, they were trying to claim that while every other living species on earth evolved into different forms, man was an exception.

Except the truth is man was not an exception. There are differences other than skin color between the peoples of the world. Bad news for liberals and leftists (people like Jared Diamond and Steven Jay Gould) who wanted to blame luck and circumstance for the differences in quality of life for the world's denizens.

36 posted on 05/11/2014 4:08:44 PM PDT by driftless2
[ Post Reply | Private Reply | To 1 | View Replies]

To: mojito

For every conservative website, magazine, or talk radio show, nobody is allowed to mention IQ as a reason for group differences for success or failure. All problems for minorities are always blamed on “government schools” and government dispensed disincentives to succeed. And there is much to blame about the state of our schools and harm caused by misguided government programs. But mentioning low IQ as a prime driver for minority failures is verboten. For speaking the truth, Derbyshire had to go.

37 posted on 05/11/2014 4:21:09 PM PDT by driftless2
[ Post Reply | Private Reply | To 20 | View Replies]

To: mojito

We use to study science as a part of our culture.
Now we tweet our knee jerk reactions.
Its not about truth, its about the club your in.
Club hell is not my desire.
The truth has become just as irrevalent as my status of living or dying in this world.
Demons are swarming our land because a nation is turning its back on God.
Come Lord Jesus, it feels like you should be here by now.

38 posted on 05/11/2014 4:23:12 PM PDT by right way right (America has embraced the suck of Freedumb.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: driftless2
There are differences other than skin color between the peoples of the world. Bad news for liberals and leftists (people like Jared Diamond and Steven Jay Gould) who wanted to blame luck and circumstance for the differences in quality of life for the world's denizens.

It's true that luck and circumstance are at work - via the genes any given creature (human or otherwise) inherits. The problem with the whole topic, however, is that - at present - it’s a true dismal science (unlike economics, which is neither truly dismal nor a science). There’s not much that can be done about a person’s essential characteristics once he’s born. Calvin was right, but with genes being the mechanism of divinely-ordained determinism.

39 posted on 05/11/2014 4:55:09 PM PDT by Zhang Fei (Let us pray that peace be now restored to the world and that God will preserve it always.)
[ Post Reply | Private Reply | To 36 | View Replies]

To: Zhang Fei
Some people bring up the Flynn Effect purporting that IQs rise every generation. In fact, some people have claimed that people today with measured IQs of 80-85 are actually more intelligent than people from the 1800s. I think that's a huge pile of bovine manure. If that were true, then the majority of the people of the 1800s, with IQs equivalent to moron level today, would have been unable to house or feed themselves.

In the 1800s, especially the latter half, people from certain parts of the earth were inventing and developing thousands of different devices and applications that would be quite beyond many people of today who would have no clue as to how to use the devices invented more than one hundred years ago.

40 posted on 05/11/2014 5:03:55 PM PDT by driftless2
[ Post Reply | Private Reply | To 39 | View Replies]

To: Zhang Fei
Tibetans who had no tolerance for high altitudes presumably either left for the lowlands outside of Tibet or died (young) of altitude sickness. In time, the only people left in Tibet were those who had that tolerance, as altitude-tolerant couples begat altitude-tolerant children.

The only people who could be born at high-altitude, where the ones whose mothers could successfully give birth at high altitude.

41 posted on 05/11/2014 5:15:10 PM PDT by PapaBear3625 (You don't notice it's a police state until the police come for you.)
[ Post Reply | Private Reply | To 34 | View Replies]

To: mojito

Thou shalt not tell the truth about race in modern America....

42 posted on 05/11/2014 9:25:36 PM PDT by Intolerant in NJ
[ Post Reply | Private Reply | To 1 | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; decimon; 1010RD; 21twelve; 24Karet; 2ndDivisionVet; ...
Thanks mojito.
Wade’s main thesis is that “human evolution has been recent, copious and regional.” He writes, “Though there is still a large random element, the broad general theme of human history is that each race has developed the institutions appropriate to secure survival in its particular environment.”
Multiregionalism, rather than the master race Replacement model? Yeah, I can see why the Slimes would fire him.

43 posted on 05/12/2014 9:05:12 PM PDT by SunkenCiv (
[ Post Reply | Private Reply | View Replies]

To: ozzymandus

Charles Murray, the author of “The Bell Curve,” reviewed Wade’s book in the Wall St Journal 2 Saturdays ago.

44 posted on 05/12/2014 9:35:53 PM PDT by Pharmboy (Democrats lie because they must.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Pharmboy
"Charles Murray, the author of “The Bell Curve,” reviewed Wade’s book in the Wall St Journal 2 Saturdays ago."

Is it possible for you to provide a link to that review? I'd like to read it.

45 posted on 05/12/2014 9:53:59 PM PDT by blam
[ Post Reply | Private Reply | To 44 | View Replies]

To: mojito

Ain’t nobody got time fo’ dat.

46 posted on 05/12/2014 10:26:00 PM PDT by martin_fierro (< |:)~)
[ Post Reply | Private Reply | To 1 | View Replies]

To: 9YearLurker

47 posted on 05/12/2014 10:36:37 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14 | View Replies]

To: caveat emptor

Hasn’t the NYT changed its slogan? I think that it’s now:

All the news that fits our views.

48 posted on 05/12/2014 10:43:46 PM PDT by Bob
[ Post Reply | Private Reply | To 17 | View Replies]

To: thecodont; Zhang Fei; mojito; SunkenCiv; All

There are some other mutation traits which have spread rapidly because they conferred survival advantage. For Europe we have the white gene which enabled people to move north from Africa because fair women could absorb Vitamin D better and produce hips wide enough to yield live young. Now, it is also believed that Neanderthal had fair skin, red hair and blue eyes, so some interbreeding may have helped too.

Another gene is the one that enables adults to drink cows milk without suffering from digestive upset. Getting rid of lactose intolerance was a great boon to farmers in Europe who had cattle. Places like China, America, etc. that lacked large bovines never spread this gene even if it did occasionally occur. Apparently, there is also a genetic basis for survival of the black death in Europe. Perhaps some are aware of other recent genes we could list.

49 posted on 05/12/2014 11:17:38 PM PDT by gleeaikin
[ Post Reply | Private Reply | To 32 | View Replies]

To: gleeaikin
Apparently, there is also a genetic basis for survival of the black death in Europe. Perhaps some are aware of other recent genes we could list.

CCR5-delta32 comes to mind.

50 posted on 05/12/2014 11:30:46 PM PDT by thecodont
[ Post Reply | Private Reply | To 49 | View Replies]

Navigation: use the links below to view more comments.
first 1-5051-66 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794 is powered by software copyright 2000-2008 John Robinson