Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Snowden: Private Explicit Photos Often Shared By NSA Agents
Ben Swann.com Blog ^ | Jul 22 ,2014 | Joshua Cook articles on InfoWars, Reason.com, WND.com, Breitbart.com, DailyCaller and FreedomOutPost

Posted on 07/22/2014 8:38:22 PM PDT by lbryce

In an interview published by The Guardian on Sunday, NSA whistleblower Edward Snowden explained that sometimes racy images intercepted by the NSA were shared by analysts.

During the interview, which was conducted in Russia, Snowden said that some of the American military personnel working on the NSA’s programs were between 18 and 22 and did not always respect the privacy of those whose communications were intercepted.

“In the course of their daily work they stumble across something that is completely unrelated to their work, for example an intimate nude photo of someone in a sexually compromising situation but they’re extremely attractive,” he said. “So what do they do? They turn around in their chair and they show a co-worker. And their co-worker says: ‘Oh, hey, that’s great. Send that to Bill down the way.’ ”

Snowden said that type of sharing occurred once every couple of months and was “seen as the fringe benefits of surveillance positions and of the privilege of being President.” He said that this was never reported and that the system for auditing surveillance programs was “incredibly weak.”

(Excerpt) Read more at benswann.com ...


TOPICS:
KEYWORDS: depravity; pornogaphy; snowden; traitor
“In the course of their daily work they stumble across something that is completely unrelated to their work, for example an intimate nude photo of someone in a sexually compromising situation but they’re extremely attractive."

Certainly, being in the course of daily work, having them ogle, share and worse when finding an intimate nude photo of someone in a sexually compromising situation but they’re extremely attractive. “So what do they do? They turn around in their chair and they show a co-worker. And their co-worker says: ‘Oh, hey, that’s great. Send that to Bill down the way.' ”

It just goes to prove there was nothing honorable, patriotic nor self-respecting of those working in the NSA that was done for patriotic reasons. They were involve in criminal acts an every once in a while, they'd get some prurient thrill coming across items og genuine privacy, that actually had zero national defense implications. But humans being being what they are, responding to prurient interests, being motivated by prurient interests, can be the strong motivator in sifting through mill=lions of documents like some desperate sexually depraved pedophile whose patients is inexhaustible for that on single picture to make his day.

So essentially, national security is driven more by sexual proclivity and prurience than anything else.

Snowden also revealed that all imagery discovered through the NSA of a certain nature would be delivered to the White House under the strictest security precautions with only a handful of black men allowed access, including Reggie Love.

1 posted on 07/22/2014 8:38:22 PM PDT by lbryce
[ Post Reply | Private Reply | View Replies]

To: lbryce

Snowden also revealed that all imagery discovered through the NSA of a certain nature would be delivered to the White House under the strictest security precautions with only a handful of black men allowed access, including Reggie Love. > sarcasm off


2 posted on 07/22/2014 8:39:31 PM PDT by lbryce (Barack Obama:Misbegotten, Bastard Offspring of Satan and Medusa.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: lbryce

Snowden is under control of Russian intelligence right now, and probably was from the very beginning. He also has been shown to be a liar, mixing lies with a little truth. I would take most of what he says with a grain of salt.


3 posted on 07/22/2014 8:40:27 PM PDT by Greetings_Puny_Humans (I mostly come out at night... mostly.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: lbryce

http://www.ebay.com/sch/i.html?_trksid=p2047675.m570.l1313.TR11.TRC1.A0.H0.Xsnowden+t-shirt+NSA&_nkw=snowden+t-shirt+NSA&_sacat=0&_from=R40


4 posted on 07/22/2014 8:40:32 PM PDT by gaijin
[ Post Reply | Private Reply | To 1 | View Replies]

To: lbryce

No surprise there.


5 posted on 07/22/2014 8:41:05 PM PDT by MichaelCorleone (Jesus Christ is not a religion. He's the Truth.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: gaijin
How come it doesn't come in pink as in, pink commie?
6 posted on 07/22/2014 8:43:27 PM PDT by lbryce (Barack Obama:Misbegotten, Bastard Offspring of Satan and Medusa.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: lbryce

No Helen Thompson photos!!!!!!!!


7 posted on 07/22/2014 8:43:33 PM PDT by 2banana (My common ground with terrorists - they want to die for islam and we want to kill them)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Greetings_Puny_Humans
Snowden is under control of Russian intelligence right now, and probably was from the very beginning.

Know why he's in Russia? Because the Chinese asked him to leave Hong Kong. And then an enraged Obama unilaterally REVOKED his passport. He had NO way to leave the airport.

Does that sound like the way a Russian asset --the biggest Russian asset and maybe the biggest intel asset in world history-- would be treated..?

He also has been shown to be a liar, mixing lies with a little truth. I would take most of what he says with a grain of salt

Kay, WHAT did he lie about…?

Who merits more trust --the President, or Snowden?

8 posted on 07/22/2014 8:54:31 PM PDT by gaijin
[ Post Reply | Private Reply | To 3 | View Replies]

To: Greetings_Puny_Humans

One of the more disturbing aspects of his disclosures is the fact that these are not “NSA” workers but outside contractors that have access to much of this material.

Like “Chelsea Manning”, with access to more secret files than they could carry? More than one million people with secret access?

They really aren’t secrets anymore.

DK


9 posted on 07/22/2014 8:55:17 PM PDT by Dark Knight
[ Post Reply | Private Reply | To 3 | View Replies]

To: lbryce

You KNOW Snowden is a traitor. /s


10 posted on 07/22/2014 9:03:27 PM PDT by VerySadAmerican (Liberals were raised by women or wimps. And they're all stupid.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: lbryce

In b4 - This thread is worthless without...


11 posted on 07/22/2014 9:12:12 PM PDT by Last Dakotan
[ Post Reply | Private Reply | To 1 | View Replies]

To: Last Dakotan

Yeah, I was gonna say, let’s take a gander ...


12 posted on 07/22/2014 9:28:24 PM PDT by tumblindice (America's founding fathers: all armed conservatives)
[ Post Reply | Private Reply | To 11 | View Replies]

To: Greetings_Puny_Humans

He is scraping the bottom of the barrel at this point.


13 posted on 07/22/2014 9:36:47 PM PDT by Williams
[ Post Reply | Private Reply | To 3 | View Replies]

To: MichaelCorleone

John Roberts!


14 posted on 07/22/2014 9:57:49 PM PDT by Texas Songwriter
[ Post Reply | Private Reply | To 5 | View Replies]

To: Greetings_Puny_Humans

When did Snowden go over to the Russians?

http://20committee.com/2014/05/31/when-did-snowden-go-over-to-the-russians/


15 posted on 07/22/2014 10:46:34 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 3 | View Replies]

To: Last Dakotan

Pictures, you say. Why didn’t you ask earlier?

Go to Google Image, Input Classified Security Key
OBAMA_FUDGEPACK Folder 1-1,000
subfolder Reggie Love 4444rqa
submit to Goole images


16 posted on 07/23/2014 12:04:17 AM PDT by lbryce (Barack Obama:Misbegotten, Bastard Offspring of Satan and Medusa.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: Greetings_Puny_Humans

The NSA was once regarded as the prestigious arm of US Intelligence, then overnight it wasn’t with fallout from around the World.

Something about the Snowden episode doesn’t square in my opinion — the timing, the drama, congressional apathy, superficial evidence, nondescript statements...


17 posted on 07/23/2014 12:18:27 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 3 | View Replies]

To: lbryce

And of course Snowden is such a reliable source... (/sarc)

Documents are documents — but when people just take his word with NO evidence whatsoever, that is beyond preposterous.


18 posted on 07/23/2014 2:10:09 AM PDT by Innovative ("Winning isn't everything, it's the only thing." -- Vince Lombardi)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dark Knight

“One of the more disturbing aspects of his disclosures is the fact that these are not “NSA” workers but outside contractors that have access to much of this material.”

That is what has bothered me from the beginning. Why all the hired outside hands getting into our most confidential business? Having served in the military there is a big difference between the culture of a sworn member of an institution serving the country, and hired hacks looking to increase profits, pare costs and give their CEO a bigger bonus.

There are some areas of government that should not have a profit motive. It is military, security, intelligence, police, prisons. Why...because the profit motive distorts justice and their mission that serves us, and works to perpetuate war and sentences in prison.


19 posted on 07/23/2014 6:48:22 PM PDT by apoliticalone (Global corporatism is the threat to freedom and rights. They want your sovereignty and politicians.)
[ Post Reply | Private Reply | To 9 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson