Free Republic
Browse · Search
News/Activism
Topics · Post Article

Winter mosquitos.

What next?

1 posted on 10/21/2021 10:03:37 AM PDT by Brookhaven
[ Post Reply | Private Reply | View Replies ]


Navigation: use the links below to view more comments.
first previous 1-2021-24 last
To: Brookhaven

Genetically modified by the Chinese to be immune to cold weather?????


37 posted on 10/24/2021 11:56:25 AM PDT by rdl6989 ( )
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brookhaven

Guess they think they can’t keep blaming camels and bats.


40 posted on 10/24/2021 3:29:57 PM PDT by mewzilla (Those aren't masks. They're muzzles. )
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brookhaven

42 posted on 10/24/2021 5:43:13 PM PDT by Rebelbase (Were State Dept. Havana Syndrome victims the guinea pigs of 5G/graphene oxide "vaccine" tests?)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brookhaven; nuconvert
We should be positive and use gene technology.

Gene drive: self-destructing mosquitoes

The process is made possible by what is called “gene drive”. This consists of introducing genetically modified organisms designed to propagate a chosen trait, in this case a gene that kills females during development. Gene drives involves distorting inheritance in favor of the gene that we are interested in being transmitted. It consists of breaking the probability that a baby has a 50% of inheriting any gene from any of the parents. Gene drives manages to raise the probability to 80-90%, thus guaranteeing that a new introduced gene spreads in the population generation after generation until the majority of individuals possess it.

http://www.mosquitoalert.com/en/gene-drive-self-destructing-mosquitoes/

48 posted on 10/29/2021 12:29:34 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]


Navigation: use the links below to view more comments.
first previous 1-2021-24 last

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson