Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Why Russia will lose this war?
Kamil Galeev via Twitter ^ | February 27, 2022 | Kamil Galeev

Posted on 09/30/2022 9:48:20 PM PDT by Zhang Fei

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-79 next last
To: Zhang Fei
So now Ukraine has 400 000+ veterans of Donbass war Many of them were in combat. Thus Ukraine has huge number of veterans with combat experience

At least someone is finally admitting the war Ukraine has been waging on Russian-speaking Donbas since 2014 was a pretty big and bloody one.

21 posted on 09/30/2022 11:06:14 PM PDT by PGR88
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei
who is Kamil Galeev?
22 posted on 09/30/2022 11:12:38 PM PDT by McGruff (Don't underestimate Joe's ability to f*** things up - Barack Obama)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei
My main criticism is technical.

The author refers to Blitzkrieg, but the technique of multiple echelons is Soviet, not German.

The Prussians and then Germans always knew that their army was too small to fight the large enemies it would be called on to combat.

So they devised a simple but very effective set of techniques:

1) Mobility: minimum logistics train;

2) multiple semi-independent groups advancing simultaneously to find the enemy;

3) The 1st group making contact pins the enemy so he can neither advance nor retreat;

4) The other units envelop the flanks, encircle the mass of the enemy's army, and annihilate it.

5) This technique of advance, pin, envelop was applied recursively. In Barbarossa, Army Group Center was to advance on Moscow and pin the mass of the Soviet Army, North and South were to outflank. This technique extended down to division, regiment, company and even squad. Wehrmacht squads had two machine gunners and two assistants. Their job was to pin the enemy with covering fire while the rest of the squad enveloped the flanks. This technique requires very well trained soldiers and officers.

Note that the point was to kill or capture and not allow the enemy to retreat, and thereby destroy the enemy's means of resistance.

What the Germans failed to count on was that Stalin's political control of the Soviet Union was greater than Hitler's in Germany. It didn't matter how many men were killed or captured. Stalin could simply order up new divisions. The Wehrmacht performed five envelopments during June - October 1941 as big as or larger than than the 1940 campaign against France, killing or capturing over 3 million Red Army soldiers. It wasn't enough.

The thin forces and lack of logistics of the Germans meant they always had a horror of partisan or "franc tireur" activity in the rear. This encouraged heavy handed atrocities as a purportedly "efficient" way of dealing with the problem. This was already a feature of the Franco-Prussian War where the Prussian/German army would just shell the heck out of any village from which fire supposedly came. It showed up again in the destruction of Louvain and other towns in reprisals in WWI. Thin logistics also meant that in a long war the Germans used forced labor and stole what they could, as they already did in occupied France in WWI.

Putin seems to be trying to reconstitute enough units to pursue a Soviet style assault. I doubt this will succeed as he doesn't have the means of adequately arming or training the soldiers he has. The only real threat to Ukraine is Putin reconstituting another front in the north from Belarus to threaten Kiev again, which would relieve pressure in the east and south. This is also the one operation that would risk direct intervention by NATO and/or Poland. And I am certain that with better artillery and missiles, the Ukrainians would attack Russian forces in Belarus. Not sure the Crap Weasel in Chief Lukashenko is willing to risk that.

23 posted on 09/30/2022 11:12:56 PM PDT by pierrem15 ("Massacrez-les, car le seigneur connait les siens" )
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei; All


Less Than $583 To Go!!
Your MONTHLY And Quarterly Donations To FR
Help "Light The Fuse" To Speed Up The Pace
Of These FReepathons!!

Sponsoring FReepers are contributing
$10 Each time a New Monthly Donor signs up!
Get more bang for your FR buck!
Click Here To Sign Up Now!


24 posted on 09/30/2022 11:18:59 PM PDT by musicman (The future is just a collection of successive nows.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kazan

Billboard in Donetsk city. "Thank you grandfather Biden for our victory."

25 posted on 09/30/2022 11:22:14 PM PDT by sockmonkey (Conservative. Not a Neocon.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: UMCRevMom@aol.com

Aiden Aslin has returned to the UK after being detained for months following his capture by Russian-backed forces in Ukraine. Speaking to the Sun on Sunday, he said after being stabbed he was asked if he wanted a quick or “beautiful death”.
1- https://fb.watch/fTByS93Pgs/
https://www.youtube.com/watch?v=P_5mBPdhLmI

2- https://www.youtube.com/watch?v=lcjDPTkwjrE


26 posted on 09/30/2022 11:27:30 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion, )
[ Post Reply | Private Reply | To 13 | View Replies]

To: Kazan
The Ukrainians will not stop fighting. They hate the Russians in a way Americans simply cannot understand. Their grandfathers continued to fight Stalin into the early 1950s. They aren't going stop, and, being backed by 60% of the world's GDP, they will continue to be adequately armed to continue.

The only way negotiations would start would be if Russia withdrew to its Feb 23 positions. Maybe the Ukrainians would concede Russia's 2014 gains, but that's it.

27 posted on 09/30/2022 11:36:13 PM PDT by pierrem15 ("Massacrez-les, car le seigneur connait les siens" )
[ Post Reply | Private Reply | To 4 | View Replies]

To: Kazan

Obviously you don’t read. It all hinges on the myth you promote here, and this myth, day by day, rings hollow.

Winning is not just pounding on someone, it also is a capacity to rebuild despite being nuked, like Japan and Germany did.

Nuclear war’s destructiveness in itself is also a myth.


28 posted on 09/30/2022 11:37:37 PM PDT by JudgemAll (Democrats Fed. job-security in hates:hypocrites must be gay like us or be tested/crucified)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Zhang Fei

Nice find. Does this guy have a further take after the intervening 6+ months?


29 posted on 09/30/2022 11:52:54 PM PDT by FreedomPoster (Islam delenda est)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei
Uh oh.

Russian forces kidnap Zaporizhzhia NPP director general
— SATURDAY, 1 OCTOBER 2022, 08:00
https://www.pravda.com.ua/eng/news/2022/10/1/7369926/

30 posted on 10/01/2022 12:12:03 AM PDT by familyop ("For they that sleep with dogs, shall rise with fleas" (John Webster, "The White Devil" 1612).)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei

Thanks. Kamil Galeev is writing very interesting threads https://threadreaderapp.com/user/kamilkazani


31 posted on 10/01/2022 1:30:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Zhang Fei

Comment at UK Mail
_____________________

BobbyC2022, Salford, United Kingdom, 2 hours ago

The main effect of Putin’s war has been to demonstrate how superior Western liberal democracy is to dictatorship. In the West generals are chosen for military competence. In Russia for loyalty to Putin. Putin’s attack on Ukraine is like Stalin’s attack on Finland in 1939. One million dead Russians and 25,000 dead Finns according to Khrushchev. And for similar reasons. Incompetent leaders. Stalin liquidated the entire professional and competent top military commanders and replaced them with incompetent loyalists. It’s a common problem of p a r a n o i d dictators like Putin and Stalin. Its even worse in the Putin era since Russia is riddled with c o r r u p t i o n from top to bottom. Everyone is on the take. Most of the money that should have gone on military spares has gone into the pockets of the mid-level Russian leaders and officers.


32 posted on 10/01/2022 1:59:24 AM PDT by dennisw
[ Post Reply | Private Reply | To 2 | View Replies]

To: Zhang Fei

Putin could have kept the aura of a powerful Russia and grabbed slices of Ukraine if he hadn’t let hubris get the better of him.


33 posted on 10/01/2022 2:27:56 AM PDT by Cronos
[ Post Reply | Private Reply | To 1 | View Replies]

To: pierrem15

Russia could have win with soft power. But it decided to crush and deny the legitimacy of Ukraine


34 posted on 10/01/2022 2:29:21 AM PDT by Cronos
[ Post Reply | Private Reply | To 27 | View Replies]

To: Zhang Fei

Russia will not lose this war . European economy will collapse . Europe will eventually break away from the USA .


35 posted on 10/01/2022 2:34:05 AM PDT by sushiman
[ Post Reply | Private Reply | To 1 | View Replies]

Russia will not lose the war?


36 posted on 10/01/2022 3:55:36 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: JudgemAll
Nuclear war’s destructiveness in itself is also a myth.

This PSA is brought to you from Moron Central.

37 posted on 10/01/2022 4:27:34 AM PDT by BlackbirdSST (Trump WON!!! The Gestapo closes ranks.)
[ Post Reply | Private Reply | To 28 | View Replies]

To: Zhang Fei

These stood out to me.
To a degree, I hope this is happening in Europe and NATO with its near-death experience of losing Russian energy as winter approaches, and the voters learning that war is not ended in European history, Russia will always be there, threatening.
“Inflicting a painful but not critical defeat on your enemy is risky. Yeah, they kinda became weaker (Ukraine’s 2014 defeat). But the balance of power within them changed. Court politics maxing interest groups lost and efficiency maxing upstarts get a chance”

And this, Ukraine is creating its future and its myth.
“Consider Venice. When Napoleon came they surrendered without a shot. Very smart, saved lives, saved the city. It’s just killed the mythos of Venice. People lived but the Republic died. It was never restored and is unlikely to be restored again
Theorists of war of the bygone age understood it. Clausewitz pointed out that it’s important not only if you lost independence but *how* you lost it. If you submitted without a fight, you saved lives. But you killed your mythos. You’ll be digested by the conqueror
But if you lost after the brutal and bloody fight your mythos is alive. The memory of the last battle will live through the ages. It will shape the mythological space your descendants live in and they’ll attempt to restore independence at the first opportunity. End of thread”


38 posted on 10/01/2022 4:53:59 AM PDT by ansel12 (NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kazan

“The Russians have already won. Donetsk, Lugansk, Kherson and Zaporizhzhia will never, ever go back to being part of Ukraine.”

Lyman (in Donetsk) was liberated by Ukraine a few hours ago. Your assertion has already been proven wrong.


39 posted on 10/01/2022 5:41:09 AM PDT by Renfrew
[ Post Reply | Private Reply | To 4 | View Replies]

To: sushiman

“European economy will collapse “

Are you aware that the last couple months Natural Gas prices in Europe have been falling? They have succeeded in replacing most of the Russian supply much faster than Putin expected.


40 posted on 10/01/2022 5:43:28 AM PDT by Renfrew
[ Post Reply | Private Reply | To 35 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-79 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson