Posted on 05/20/2003 2:05:10 PM PDT by kkindt
A new report argues that chimpanzees are so closely related to humans that they should be included in our branch of the tree of life. Chimpanzees and other apes have historically been separated from humans in classification schemes, with humans deemed the only living members of the hominid family of species
(Excerpt) Read more at news.nationalgeographic.com ...
Statements like this always make me chuckle. Like they know that an event occurred 5,000,000 years ago. LOL. Until another scientist proves them wrong in the future they cling to this b.s. The agenda driven pseudo scientists are out in force when it comes to this issue. But they forget to tell you that human and cat DNA is about 90% similar. In tracing the origin of a life form, DNA can no more be used as the final word than a Democrat's lips can be used for telling the truth. Notice they don't dare use the word "proof" when they talk about human and chimp DNA, they use the word "evidence", which means nothing in true science. True science deals in proof, not "evidence", and they still cannot prove humans evolved from chimps any better than they could when they placed human teeth in a gorilla skull and called it "Piltdown man". lol. They need to stop presenting this theoretical crap as though it were fact.
This is a nonsense. As someone said: "Nearly 75% of human genes have some counterpart in nematodes--a soil-dwelling worm that is about four thousandths of an inch long. Does that mean that a nematode is 75% human?"
There is a misleading and prevailing misconception that each organism or a cell develops out of DNA. It never happens, during the division of already existing cell the DNA gets replicated and inherited by each cell to be used as a library of genes. During the seuxal reproduction, DNA gets recombinated inside of already existing cells. Very different species can use even the same library in a different way and order.
They presented it as it is.... a theory.... that will hold up or not with further study. That is what science is, the study of things.... Some things that are proved, some things smart people may disagree on, and some things still baffle us.
The knee-jerk emotional dissmissal of this theory is much less scientific than the original theory. And presented here with much more *certainty* as fact.
I think this statement, like the chimp b.s., is more wishful thinking on your part than reality. St. Augustine, who died in the 5th Century, was a man who loved science right to his death, and he wrote that the earth was round and that "the earth is probably inhabited on the other side". Some people still attempt to use the Galileo fiasco as "proof" that Christians feared scientific "fact", but they conveniently forget that Galileo was educated in Catholic schools of science, by Catholic scientists. Whether or not the earth is the center of the universe has yet to be proved or disproved by science. Isn't it strange that the U.S. Navy, and N.A.S.A. both navigate by the geocentric principle,(the one that Galileo tried to replace with his heliocentricity). People of true faith do not fear science, they fear false science, and outcomes that are determined more by an agenda than by facts.
We have this really smart terrier, who, when she isn't being stubborn, perfectly understands commands like, "go into your cage" and "go outside." Sometimes we will give the commands without gesturing or looking in the desired direction, and the dog will go one way or the other, depending on whether we say "outside" or "cage." I don't think dogs understand grammar or anything like that, but they are smart enough to associate certain noises we make with certain behavior we expect of them. I would imagine that chimps can understand even more.
I do have a nightmare where corrupt politicians will have voting machines set up for chimps. It will feature a picture of a banana and when the chimp touches it, it will count as a vote! Anything is possible in a country where dead people vote for live politicians and, more recently, live people have voted for a dead politician. Our political system might go from bread and circuses to bananas and zoos!
After all, they share 100% of our genetic code.
I mean fair is fair, no?
OK - I must not have seen many of true faith then, because I see agenda coming out here without a lot of facts.
Isn't it strange that the U.S. Navy, and N.A.S.A. both navigate by the geocentric principle
I would guess that is most helpful getting around here... the only relevant motion is the motion relative to us. If we left the earth, I would guess that would be less helpful to us.
That is the harmony of nature.
Such events leave lots of evidence -- in the fossil record and in the genetic record. No one saw O.J. whack his wife, but the evidence most certainly points in that direction.
Some dolphins brains are bigger than yours and mine.
I am going to hire Flippers grandson to defend me at the next monkey trial. (It's going to be hard convincing the judge to hold the trial at Sea World though).
Science has nothing to do with common sense!
For tens of thousands of years, early man (indistinguishable from modern man, biologically) didn't learn any new tricks either. The development of a complex language may have been what finally allowed early man to start building a "technology base" across generations. Chimps are handicapped in this regard because their vocal chords are far less intricate than ours, and they are physically unable to make any kind of complex sounds.
A wild chimp's only tool-using skill is to fish for insects with sticks.
That's not the only skill. Here's one example in the wild, and others self-taught in capitivity
The operable word is "person".
Of course I think academics who consider babies in the womb something other than human or persons are not worth listening to.
In fact, like the Professor who wouldn't issue recommendations to students who didn't toe the line on evolutionary theory, I wouldn't recommend those academics for toilet paper tester.
Not only that. Educated people knew not only that the Earth is round much earlier, but they even knew the SIZE of the Earth. See the Eratosthenes (276-196 BC) experiment. The very reason why Catholic Spanish leaders were hesitant to pay for Columbus expedition is that they knew better than Columbus the size of the Earth and that India is too far.
Troy McClure: I hate every ape I see,
From chimpan-A to chimpanzee,
No, you'll never make a monkey out of me!
(Statue of Liberty rises)
O my! I was wrong!
It was Earth, all along!
You've finally made a monkey,
Apes: Yes we've finally made a monkey,
Troy: Yes you've finally made a monkey out of me!
(To borrow from someone's Simpson's webpage)
Especially the EDTA (laboratory preservative) in the blood stains.
It doesn't work that way. I don't know what misconception people have that leads them to believe this. But it seems to be very common.
Statements like this always make me chuckle. Like they know that an event occurred 5,000,000 years ago.
Yes, indeed they do. There is massive evidence for such a conclusion.
Until another scientist proves them wrong in the future they cling to this b.s.
Okay, I'll bite -- what's *your* evidence to the contrary "proving" them wrong? After all, you must have some in order to be able to denounce it as "b.s.". Or are you just mouthing off without support?
The agenda driven pseudo scientists are out in force when it comes to this issue.
Which issue would that be?
But they forget to tell you that human and cat DNA is about 90% similar.
They don't "forget" to say that at all -- you learned that from a scientist who measured it, son. Furthermore, cats and humans and all mammals (yes, humans are mammals) *are* very much more similar than not. We share enormous amounts of physical structure and body chemistry.
In tracing the origin of a life form, DNA can no more be used as the final word than a Democrat's lips can be used for telling the truth.
Ah, right, the old "let's just ignore the most detailed, voluminous evidence" trick.
Notice they don't dare use the word "proof" when they talk about human and chimp DNA, they use the word "evidence", which means nothing in true science. True science deals in proof, not "evidence",
This is a remarkably ignorant statement. Quite the contrary, science deals in evidence, not proofs. The only "proofs" are in mathematics, where the artificial nature of the field allows enough rigor to make "proofs" possible. Any other science has to get by on "what does the evidence seem to support, and how strongly?", because no matter how much you may kid yourself that you have "proven" something in the real world, there are always other conceivable explanations which may turn out to be more consistent with future discoveries. There are no "proofs" in science.
and they still cannot prove humans evolved from chimps
Humans *didn't* "evolve from chimps", although we do share a common ancestor. Were you sleeping through your science classes?
any better than they could when they placed human teeth in a gorilla skull and called it "Piltdown man".
That's even a grossly inaccurate description of the Piltdown hoax. You need to work on getting your facts straight. But if you think the massive amounts of evidence for the nature of human origins isn't "any better" than the *one* dishonest hoax in human paleontology in over a century (and do you really want me to start listing the many creationist hoaxes?), then you're hopelessly ignorant of this field. Not, I notice, that your lack of knowledge prevents you from stating your uninformed opinions anyway.
They need to stop presenting this theoretical crap as though it were fact.
It's hardly "theoretical crap", but your mind is obviously closed, I won't waste my time leading you to knowledge.
Enjoy your presumptions.
That is correct, but ours have far more convolutions (folds), thus the surface area of our brains is larger. That's one of the reasons we are smarter than dolphins, and also why we are smarter than apes. Our brains are far more evolved or advanced.
WHAT IS HOMO?
The early species Homo rudolfensis and H. erectus did not reach the brain capacity of the Neanderthals (1,600 cc) or H. sapiens (1,350 cc), but the increase from the australopithecine brain of 450 cc to the 700-900 cc of H. rudolfensis is almost a doubling of size and a much greater advance than the shift from 900 cc to 1,350 cc, an increase that I do not consider to be of generic value. A genus usually indicates an ecological unit, a noticeable difference in the exploitation of the environment. The designation Homo does have such a significance. It designates the emancipation from dependence on trees. Once this independence was achieved, a premium was placed on the enhancement of intelligence, provided the evolutionary unit was small enough to respond to selection. The evolutionary increase of brain size ended when selection for further increase was no longer rewarded by a reproductive advantage.
Ernst Mayr, What Evolution Is (2001), pg 235
Or it can lead to lawyers arguing for man's chimp-rights, which might turn out to be quite a leap forward for human rights, especially in some states.
This is a nonsense.
You're welcome to present your own DNA studies which show anything to the contrary. Oh, right, you don't have any.
As someone said: "Nearly 75% of human genes have some counterpart in nematodes--a soil-dwelling worm that is about four thousandths of an inch long. Does that mean that a nematode is 75% human?"
No, because you've obviously pulled a dishonest bait-and-switch. The original statement was that Chimp and Human DNA was 98+% *IDENTICAL*. And it is.
Suddenly, you're talking about only having "some counterpart", which is a *much* broader type of comparison. Furthermore, your creationist source has further stretched the comparison... While the human/chimp comparison is across the *entire* genome, the alleged "75%" comparable human/nematode comparison is only that "Of the 5000 best known human genes, three fourths have close analogues in the nematode." (Note that 5000 human genes is only 6% of the *total* number of human genes.) So only a *partial* comparison of "close analogues" turns up 75% "similarity" (not 75% exact match). Also note that the "best known" human genes are quite commonly the ones that run the basic cellular machinery, which *would* be more likely to be shared in at least some form with other multi-celled animals -- the genes that make us more uniquely human are mostly still in the territory of "unknown" genes.
To further demonstrate the dishonesty of the implied "75% same" claim, note that the nematode DNA has only 97 million base pairs of DNA, compared to 3,000+ million base pairs for humans. Human DNA has over THIRTY TIMES THE VOLUME of information as the nematode DNA. Even if *every* nematode DNA sequence matched *exactly* a human DNA sequence (and they sure as hell don't), that would at *MOST* make for only a 3.2% human/nematode DNA match. And that's the *absolute maximum* amount of match that could *possibly* exist, since the entire nematode DNA is only 3.2% as large as the human DNA. Your creationist source sort of "forgot" to point that out, didn't it?
When are you folks going to stop believing what creationist sources try to mislead you into believing about science?
To further underscore the dishonest implications of the creationist claims, let's look at one of the "similar" genes, shall we? The following is an actual comparison between a gene in nematodes (top line, UNC-76) and the homologous gene in humans (bottom two lines, FEZ1 & FEZ2):
Note that even what the creationist source tries to imply as one of the "gene matches" is actually vastly different when you look at the actual amino acid sequences. Not only are there dozens of mismatched amino acides, but the sequences are differing lengths, and there are many insertion/deletion differences (marked by the dashed lines to stretch one sequence to match up with the other).
(The above is from The Caenorhabditis elegans gene unc-76 and its human homologs define a new gene family involved in axonal outgrowth and fasciculation)
So, rather than "75% the same", what we *really* find when we compare nematode DNA versus human DNA is that when you look at only the best known 6% of human genes (which are mostly regulatory and likely to be found in many creatures), about 75% of them can be matched to *some* superficially similar gene in a nematode, even though the "matches" show gross differences in length, encoding, and sequences which are present in one but not the other (and vice versa), making for a "half match" at best. By my math that's a 2.25% overall "match" at best.
Human/Chimp comparisons of similar genes, on the other hand, show far tinier differences -- in keeping with the 98+% similarity. For example, check out this comparison of human/chimp/gorilla/orangutan CHRM2 gene for muscarinic acetylcholine receptor m2. The human gene sequence is on the top 2 lines (from 2 different gene sequencing projects), the following lines are for the other primates. A "." indicates an identical match, a letter indicates a differing base pair.
seq id sequence name
-----------------------------
1 human (M16404 in Database) - local file -
2 human (SN; AB041391 determined by Silver Project) - local file -
3 chimpanzee (220; AB041392 determined by Silver Project) - local file -
4 gorilla (U1; AB041393 determined by Silver Project) - local file -
5 orangutan (U1; AB041394 determined by Silver Project) - local file -
nucleotides 1 - 60
1 ttgtcctggtggctggatccctcagtttggtgaccattatcgggaacatcctagtcatgg
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 61 - 120
1 tttccattaaagtcaaccgccacctccagaccgtcaacaattactttttattcagcttgg
2 ............................................................
3 ............................................................
4 .................................................g..........
5 ...............................t.................g..........
-------------------------------+-----------------+----------
nucleotides 121 - 180
1 cctgtgctgaccttatcataggtgttttctccatgaacttgtacaccctctacactgtga
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 181 - 240
1 ttggttactggcctttgggacctgtggtgtgtgacctttggctagccctggactatgtgg
2 ............................................................
3 ............................................................
4 ............................................................
5 .........................t..................................
-------------------------+----------------------------------
nucleotides 241 - 300
1 tcagcaatgcctcagttatgaatctgctcatcatcagctttgacaggtacttctgtgtca
2 ............................................................
3 ............................................................
4 ............................................................
5 .............g..............................................
-------------+----------------------------------------------
nucleotides 301 - 360
1 caaaacctctgacctacccagtcaagcggaccacaaaaatggcaggtatgatgattgcag
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 361 - 420
1 ctgcctgggtcctctctttcatcctctgggctccagccattctcttctggcagttcattg
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 421 - 480
1 taggggtgagaactgtggaggatggggagtgctacattcagtttttttccaatgctgctg
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 481 - 540
1 tcacctttggtacggctattgcagccttctatttgccagtgatcatcatgactgtgctat
2 ............................................................
3 ............................................................
4 ................c...........................................
5 ................c.........................................g.
----------------+-----------------------------------------+-
nucleotides 541 - 600
1 attggcacatatcccgagccagcaagagcaggataaagaaggacaagaaggagcctgttg
2 ............................................................
3 .................................................a..........
4 ............................................................
5 .c..........................................................
-+-----------------------------------------------+----------
nucleotides 601 - 660
1 ccaaccaagaccccgtttctccaagtctggtacaaggaaggatagtgaagccaaacaata
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 661 - 720
1 acaacatgcccagcagtgacgatggcctggagcacaacaaaatccagaatggcaaagccc
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 721 - 780
1 ccagggatcctgtgactgaaaactgtgttcagggagaggagaaggagagctccaatgact
2 ............................................................
3 ............................................................
4 ............................................................
5 ....a................................a......................
----+--------------------------------+----------------------
nucleotides 781 - 840
1 ccacctcagtcagtgctgttgcctctaatatgagagatgatgaaataacccaggatgaaa
2 ............................................................
3 ............................................................
4 ............................................................
5 ........................................c...................
----------------------------------------+-------------------
nucleotides 841 - 900
1 acacagtttccacttccctgggccattccaaagatgagaactctaagcaaacatgcatca
2 ............................................................
3 ............................................................
4 ............................................................
5 .......c................................t...................
-------+--------------------------------+-------------------
nucleotides 901 - 960
1 gaattggcaccaagaccccaaaaagtgactcatgtaccccaactaataccaccgtggagg
2 ............................................................
3 ............................................................
4 ............................................................
5 ...................c....t.............t.....................
-------------------+----+-------------+---------------------
nucleotides 961 - 1020
1 tagtggggtcttcaggtcagaatggagatgaaaagcagaatattgtagcccgcaagattg
2 ............................................................
3 ............................................................
4 ............................................................
5 .......a....................................................
-------+----------------------------------------------------
nucleotides 1021 - 1080
1 tgaagatgactaagcagcctgcaaaaaagaagcctcctccttcccgggaaaagaaagtca
2 ............................................................
3 ............................................................
4 ................n...........................................
5 ............................................................
----------------+-------------------------------------------
nucleotides 1081 - 1140
1 ccaggacaatcttggctattctgttggctttcatcatcacttgggccccatacaatgtca
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 1141 - 1200
1 tggtgctcattaacaccttttgtgcaccttgcatccccaacactgtgtggacaattggtt
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 1201 - 1260
1 actggctttgttacatcaacagcactatcaaccctgcctgctatgcactttgcaatgcca
2 ............................................................
3 ....................................................t.......
4 ....................................................t.......
5 ....................................................t.......
----------------------------------------------------+-------
nucleotides 1261 - 1320
1 ccttcaagaagacctttaaacaccttctcatgtgtcattataagaacataggcgctacaa
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 1321 - 1332
1 ggtaaaa-----
2 ............
3 .......tatct
4 ............
5 ............
-------+++++
Note the *huge* stretches of hundreds of absolutely *identical* basepairs. The chimp gene differs from the human gene by only *TWO* base pairs out of 1327 base pairs (plus 5 base-pairs of probable "junk" on the end, genes often have "fuzz" on either end, but even 7 out of 1332 bp differences is only 0.5% difference, or 99.5% similarity). Note also that the gorilla gene differs more from the the human DNA than does the chimp, and the orangutan even moreso. This implies a "family tree" of:
0
1 +--- 1 humDB
+---| 0
2 | +--- 2 humSN
+---| 1
| +------- 3 chi220
+---| 0
| +----------- 4 gorU1
| 14
+--------------- 5 oranU1
And the next time you want to present what you think are scientific facts, try getting them from science sources instead of creationist sources.
There is a misleading and prevailing misconception that each organism or a cell develops out of DNA.
It does.
It never happens, during the division of already existing cell the DNA gets replicated and inherited by each cell to be used as a library of genes.
Yes, exactly. And the additional "cell machinery" for the doubled cell is built via instructions from the DNA (both nuclear and mitochondrial).
During the seuxal reproduction, DNA gets recombinated inside of already existing cells.
Yes, so?
Very different species can use even the same library in a different way and order.
You are invited to document this amazing claim.
Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.