Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Obama weighs selling U.S. arms to Hanoi in bitter irony for Vietnam veterans
Washington Times ^ | 5/22/16 | Dave Boyer

Posted on 05/22/2016 7:33:00 PM PDT by Nachum

In a move that is raising concerns among some Vietnam War veterans, President Obama will discuss selling more U.S. arms to Hanoi during his visit to Vietnam that began Sunday night.

Top White House advisers said Mr. Obama hasn’t made a decision whether to lift the partial U.S. embargo on sending military equipment to Vietnam, where more than 58,200 U.S. soldiers were killed before the fall of Saigon in 1975. But the administration sees advantages in easing the embargo, both as a warning to expansionist China and as leverage to compel the communist regime in Hanoi to improve its record on human rights.

“We are thinking through how our evolving security cooperation [is] going to look moving forward,” said White House Deputy National Security Adviser Ben Rhodes. “They regularly raise this issue with us. We are looking at, of course, how our broader relationship is evolving, including our continued commitment to support human rights in Vietnam.”

The notion of selling more lethal weaponry to Vietnam is a bitter irony to some veterans of the war and to some Vietnamese-Americans who fled the communists.

“They are still a communist country,” said retired Army Maj. Wulf Linden, a Georgia resident who served two tours in Vietnam. “If it’s the cream of our crop [of weapons systems], obviously that would be a bad mistake. It would be nice if we’re not selling to a regime that’s a documented communist regime. That’s my concern.”

(Excerpt) Read more at washingtontimes.com ...


TOPICS: News/Current Events
KEYWORDS: arms; armstohanoi; armstovietnam; china; obamavietnam; veterans; vietnam; vietnamvets; vietnamwar
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-65 last
To: Shady

And we get a quote from the lying Ben Rhodes who laughed about how he lied about the Iranian “DEAL”? Stopped reading right there!


61 posted on 05/23/2016 4:35:58 AM PDT by blaveda
[ Post Reply | Private Reply | To 53 | View Replies]

To: ThanhPhero; SunkenCiv

I agree, this is a positive step.


62 posted on 05/23/2016 4:36:42 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 48 | View Replies]

To: Nachum

“Bitter irony”?
How about “outright betrayal”?


63 posted on 05/23/2016 4:44:58 AM PDT by ctdonath2 ("Get the he11 out of my way!" - John Galt)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Nachum

Obama is trying to undercut Richard Roper.


64 posted on 05/23/2016 7:45:33 AM PDT by pas
[ Post Reply | Private Reply | To 1 | View Replies]

To: Doogle
Chelsea is going to run the FOUNDATION, should Hillary get selected? can you believe? and yes, she is the spiting image of her DNA poppa.

So thanks for reminding me to add her...

65 posted on 05/23/2016 8:06:59 PM PDT by haircutter
[ Post Reply | Private Reply | To 50 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-65 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson