Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Why Everyone Loves Big Oil
Townhall.com ^ | August 4, 2017 | David Spady

Posted on 08/05/2017 5:13:11 AM PDT by Kaslin

click here to read article


Navigation: use the links below to view more comments.
first 1-2021 next last

1 posted on 08/05/2017 5:13:11 AM PDT by Kaslin
[ Post Reply | Private Reply | View Replies]

To: Kaslin

When people envision a return to a bucolic pre-industrial world, they usually see themselves as somehow part of the protected elite living in the high tower overlooking the people they care so deeply about. They usually don’t envision themselves as one of the people slogging behind the water buffalo plowing the fields.


2 posted on 08/05/2017 5:18:34 AM PDT by marron
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kaslin

I call it the “Thin Chrome Line”. You have all these people who hate Big Oil, Big Pharma, Big Agriculture. They tell us to use less oil, refuse GMO food, eat organic, live small, etc.

But their life is not only made comfortable, it is actually made possible in a world of 7B+ people by these things. Their First World comfort makes them stupid, and it is only First World prosperity that allows idiots like them to survive and have a voice.


3 posted on 08/05/2017 5:20:38 AM PDT by Bryanw92 (If we had some ham, we could have ham and eggs, if we had some eggs.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kaslin

An Incoherent Blowhard.


4 posted on 08/05/2017 5:24:11 AM PDT by reg45 (Barack 0bama: Gone but not forgiven.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: reg45

You got it.


5 posted on 08/05/2017 5:24:49 AM PDT by Kaslin (Civilibus nati sunt; sunt excernitur - Politicians are not born; they are excreted. (Cicero)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Kaslin

Ten years ago Al Gore ...was 150 lighter?

https://www.youtube.com/watch?v=dMztmooCUfU


6 posted on 08/05/2017 5:31:19 AM PDT by Leep (Less talk more ACTiON!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kaslin

150 lbs..that is


7 posted on 08/05/2017 5:31:55 AM PDT by Leep (Less talk more ACTiON!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kaslin

Fossil fuels made slavery economically non viable.


8 posted on 08/05/2017 5:33:32 AM PDT by reg45 (Barack 0bama: Gone but not forgiven.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: reg45

Liberals came up with endless taxes and fees to make tax slavery a lifestyle.


9 posted on 08/05/2017 5:41:17 AM PDT by wally_bert (I didn't get where I am today by selling ice cream tasting of bookends, pumice stone & West Germany)
[ Post Reply | Private Reply | To 8 | View Replies]

To: wally_bert
” to make tax slavery a lifestyle.”
When gas was $4 a gallon under oBama Exon made $4B profit and paid $35B in taxes. Energy is the slave masters cash cow
10 posted on 08/05/2017 5:45:49 AM PDT by mountainlion (Live well for those that did not make it back.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Kaslin

The petrochemical industry is basically responsible for our modern way of life.

Far more to it than what goes in the gas tank.

Have had many conversations with average people who are absolutely clueless about how much “oil” is around us.


11 posted on 08/05/2017 6:06:44 AM PDT by headstamp 2 (Ignorance is reparable, stupid is forever)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kaslin

[When seasonal warming does occur in the Northern Hemisphere, air conditioning is not only cool, it’s something most people take for granted, at least in hot southern states.]

A/C is basically responsible for the development of the modern south.


12 posted on 08/05/2017 6:09:06 AM PDT by headstamp 2 (Ignorance is reparable, stupid is forever)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kaslin
The distribution transformer on a pole two doors down spectacularly exploded last night around 7:30 PM. Horrors...we spent 11 hours without electricity. The house was dark, the gazillion LEDs weren't glowing, there was no hum of the myriad motors and fans throughout the house. Then the battery drained on the home security system and it started a steady beeping every 20 seconds informing me we were in a low battery condition. My quick-thinking wife finished the Macadamia Nut Ice Cream before it could melt...thanks for little blessings. The power crews are amazing...working through the black night in the backyards of suburban homes. We didn't hear a single thing all night long. Kudos to those guys who are working day and night 365 days a year to keep us safe and warm.

The power came on this morning at 6:30 AM, so our ordeal is over.

Great article. I make the same point to all who will listen - fossil fuels are embedded in everything you touch and use all day long.

Heres' one personal example. When I worked in China in the mid 70s, I saw a pit saw mill in one of the villages I was working in. Having been born and raised in the US, I had never heard of a "pit saw mill" before...but there they were being used in poor rural China. Before that, I had never really thought much about life without fossil fuels and electricity. It was a real eye-opener. Without fossil fuels, you wouldn't be buying 2x4s for $3 down at the lumber yard and plywood wouldn't even exist.


13 posted on 08/05/2017 7:06:47 AM PDT by ProtectOurFreedom
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kaslin

Not Jimmy Carter, Al Gore, and the Greenies.


14 posted on 08/05/2017 7:55:30 AM PDT by SandRat (Duty, Honor, Country.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kaslin

“Camera lost down hole.”


15 posted on 08/05/2017 8:50:22 AM PDT by onedoug
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kaslin
No innovation developed by mankind has had more positive impact on quality of life than the use of fossil fuels – particularly oil. The wheel made mobility easier, but oil revolutionized transportation. The modern world is now dependent on oil for almost every aspect of our lives. Oil products not only allow people to move from one place to another quickly and comfortably, but our entire economy also depends on the transportation of commodities, raw materials, and food.
. . . and people wonder why John D. Rockefeller was fabulously wealthy. Rockefeller invented the refining and distribution of oil as a commodity.
. . . there is no debate that we all, including environmentalists, love the quality of life benefits gained from fossil fuels…and Big Oil.
Al Gore certainly proves that every time he pays his fuel bill.

16 posted on 08/05/2017 9:35:23 AM PDT by conservatism_IS_compassion (A press can be 'associated,' or a press can be independent. Demand independent presses.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: All

Big Oil saved the whales. A ‘modern’ (19th Century) whaling industry would have extincted the great whales — the chief source for lamp oil — before the arrival of electrification if Rockefeller’s Standard Oil Company hadn’t developed the means to produce uniformly high-quality kerosene for 6¢ a gallon. Instead of whalers hunting the great whales to extinction, Rockefeller almost extincted the whaling industry.

Without petroleum-based pesticides and artificial nitrogen fixation chemicals (Haber-Bosch process), it would take 150% MORE acres of croplands than currently in use to feed the world’s population. 250% of that currently in use.

In 1910 (pre-petroleum), America’s agriculture industry was powered by 28 million horses, mules and oxen, which required more than a quarter of the total farm output to feed. Extrapolate that 28 million with the rise in US population and feeding the all the draught animals today would require a farm about twice the size of California.


17 posted on 08/05/2017 11:54:54 AM PDT by Paal Gulli
[ Post Reply | Private Reply | To 16 | View Replies]

To: Kaslin

One word...

https://www.youtube.com/watch?v=PSxihhBzCjk


18 posted on 08/06/2017 5:23:54 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kaslin

As an employee of big oil I approve this post.

Ironically it was the oil industry that bailed out the Obama economic policy by creating thousands of high paying jobs in North Dakota, Texas and elsewhere to boost US production. This increased production also helped to keep the price low for US consumers and also to keep inflation low, thus permitting the loose Fed policies.


19 posted on 08/06/2017 8:55:20 AM PDT by KingofZion
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kaslin

I don’t love big oil.

I understand them paying their lawyers.

I was a bit surprised when they paid ours, too.

Lawyers and big oil.....screw them.


20 posted on 08/06/2017 8:58:16 AM PDT by blueunicorn6 ("A crack shot and a good dancer")
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson