FreeRepublic.com "A Conservative News Forum"
[ Last | Latest Posts | Latest Articles | Self Search | Add Bookmark | Post | Abuse | Help! ]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Descent of Man Theory: Disproved by Molecular Biology

Miscellaneous News Keywords: HUMAN ORIGINS MOLECULAR CLOCK CREATIONISM
Source: God and Science
Published: 6/22/01 Author: Richard Deem
Posted on 07/07/2001 20:47:05 PDT by Ahban

Descent of Man Theory: Disproven by Molecular Biology a { color: blue } a:hover { color: red } a:visited { color: purple } a:active { color: lime }

GodAandScience.org

Descent of Man Theory: Disproved by Molecular Biology
by Richard Deem

Introduction

The current theory of human evolution states that modern humans evolved from more primitive bipedal hominids. The first bipedal hominid genus that is supposedly the ancestor of modern humans is Australopithecus, which appeared in the fossil record from about 4.4 to 1 million years ago throughout eastern Africa. Australopithecus comprised a diverse group of small-brained bipedal species that were confined to the savannas of Africa. This genus was supposed to have evolved into the genus  Homo, which has been defined as bipedal primates with a brain capacity over 700 cc, having appeared in the fossil record by about 2 million years ago as Homo habilis in eastern Africa. According to theory, Homo habilis evolved into Homo erectus, which had a brain capacity just over 1000 cc, appearing in the fossil record from about 1.5 million to 300 thousand years ago. Homo neandertalensis lived between 400 and 28 thousand years ago. Archaic Homo sapiens appeared 400 - 150 thousand years ago, and modern Homo sapiens from less than 100 thousand years ago. Contrary to the claims of many creationists, there is ample evidence for the existence of human-like species of bipedal primates. The dates and ages of these fossils are not widely disputed in scientific circles. The reality of the fossil record and the reliability of the dates of these fossils is actually instrumental in disproving the descent of man theory. If the fossil record were not as complete as it now is, the standard evolutionist argument would apply, "we just haven't found the missing link ancestor of modern humans yet."

The beginning of trouble - lack of genetic diversity among modern humans

As evolutionists studied humans and species of apes in the 1970's and 1980's, some rather surprising information was being discovered that distinguished us from apes and other primates. The maximum Fst value (a measure of variation between population groups) between human races is 0.08 (1, 2). However, among populations of chimps, orangutans, and other primate species, Fst values are commonly more than 0.20. An examination of 62 common protein coding genetic loci, indicates a substitution rate of 0.011/locus (Caucasoids versus Mongoloids), to a maximum of 0.029 (Mongoloids versus Negroids). However, in nearly all other animal species studied, including apes, usually exceed 0.05 (2). In humans, heterozygosity (the proportion of alleles that are polymorphic, in this case within the species) is 1.8% , whereas in apes it ranges from 2.5 in the Orangutan to 3.9 in the Chimpanzee (3). An analysis of the genetics of  populations of apes reveals that different population groups possess fixed novel mutations that characterize each population. In contrast, there are no novel mutations or genetic alleles that specifically characterize any one human race from another. More recent studies have confirmed the early work, likewise showing that human genetic diversity is far less than what one would predict from Darwinian theory. Dr. Maryellen Ruvolo (Harvard University) has noted, "It's a mystery none of us can explain." (4). Examinations of the genetic sequences of diverse modern human populations reveals minor, if any differences (5). All of this evidence suggested a recent origin for modern humans.

Still more trouble - Discontinuous morphological changes in the hominid lineage

braincapac.gif (2725 bytes)Paleontological discoveries and geochronology show that the pattern of morphological change in the hominid fossil record was not progressive, but abrupt (6). Some adaptations essential to bipedalism appeared early, but others appeared much later. Although the 3.2 million year old fossil "Lucy" (Australopithecus afarensis), was said to be bipedal, her 2.6 million year old descendent, Australopithecus africanus, was indisputably arboreal (7). Primitive craniodental complexes (similar to the reconstructed last common ancestor with the African great apes) were found in nearly all species of Hominidae (8). Relative brain size increased slightly among successively younger species of Australopithecines, although many Australopithecine skulls have brain capacities no larger than those of chimpanzees. (9, 10). However, brain capacities expanded abruptly with the appearance of Homo, but within early Homo remained at about half the size of Homo sapiens for almost a million years. The fossil record indicates an accumulation of relatively rapid shifts in successive species, and certainly not any kind of gradualistic changes.

Another problem - too many deleterious mutations

A recent study examined the mutation rate for humans. Using "conservative assumptions" the authors found that the overall mutation rates was 4.2 mutations per person per generation, with a deleterious rate of 1.6 (11). When using more realistic assumptions the overall mutation rate for humans become 6.7 with a deleterious rate of 3.1. Such a high rate should have resulted in extinction of our species long ago. They stated in their conclusion:

"The deleterious mutation rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if mutational effects on fitness were to combine in a multiplicative way."

The authors had to rely upon a rare association of mutations, termed synergistic epistasis to explain why the numerous hypothesized deleterious mutations have not overwhelmed our genome. Instead of postulating the obvious (that the human genome is not as old as evolution would teach), evolutionists must rely upon the improbable to retain the evolutionary paradigm.

Recent origin of modern humans confirmed through molecular biology

Mitochondrial DNA (mtDNA)
In the late 1980's and early 1990's a number of studies were done examining the mitochondrial DNA (mtDNA) of women all over the world. These studies, nicknamed the "Eve theory," suggested that the last common ancestor of modern man (actually women) appeared within the last 200,000 years (12-15), much more recently than previously thought. Refinements in the measurements lowered the original estimates to 135,000 years (15) and finally 100,000 years (19). Scientists chose to examine mtDNA because, being enclosed within the subcellular organelle called the mitochondrion, there is no genetic recombination (males make no contribution of mtDNA to the fetus). All mtDNA comes from our mothers and is passed down from mother to daughter, since only mitochondria from the egg are used to make up the fetus. By tracing the differences in mtDNA from peoples around the world, scientists have calculated the probable date of the last common ancestor of modern humans at 100,000 to 200,000 years ago.

Y-chromosome analysis
In 1995, scientists have examined human origins from the perspective of male genetics (16, 17). Scientists have examined a gene (ZFY), which being on the Y chromosome, is passed down only from father to son. Thirty-eight men were chosen from all over the world (Africa, Asia, Australia, Europe, and Northern, Central, and South America). Scientists determined the actual genetic sequence in each man for this gene, which is 729 base pairs long. To their surprise, all men had identical genetic sequences (over 27,000 base pairs analyzed). Scientists have calculated the most probable date for the last common ancestor of modern man, given the sequence diversity from modern apes. Using two different models this date is either 270,000 or 27,000 years ago. However, both these models assume that the male population during this entire period of time consisted of only 7,500 individuals. The date estimates from these models would be significantly reduced if the male population were higher than 7,500, which is very likely. Two separate studies using similar techniques looked at larger pieces of the Y chromosome, which would reduce the uncertainty in the calculation of dates. One study examined a gene which was 2,600 base pairs and determined a last common ancestor date of 188,000 year ago (minimum of 51,000 and maximum of 411,000 years ago) (18). The other study used a very large piece of the Y chromosome (18,300 base pairs) and calculated a last common ancestor date of modern man of 43,000 years ago (minimum of 37,000 and maximum of 49,000 years ago) (19). This latter study also examined mitochondrial DNA from women and determined an origination date of 90,000-120,000 years ago.

Linkage disequilibrium analysis
A studied published in 1996 (20) examined linkage disequilibrium at the human CD4 locus (a T-cell associated antigen) as a means to establish the date of modern human origins. This study determined a maximum origin date of 102,000 years ago based upon the assumption that the Alu (-) allele arose 5 million years ago, or almost immediately after mankind's split from other primates. As they stated, "It is likely that the Alu deletion event occurred more recently, in which case our estimates for the date of founding of the non-African populations would also be more recent." Preliminary studies from chromosomes 19, 11 and 8 show similar results to that seen on chromosome 12 (the locus of the CD4 gene) (21).

Using rare mutations to estimate population divergence times
A study published in December, 1998 examined population divergence time using rare mutations between populations to estimate divergence among three Mediterranean populations. The results indicated that Danish people (who are my ancestors) would have diverged from the other groups, at most, 4,500 to 15,000 years ago (22). This number does not necessarily help us establish a date for the appearance of modern humans, but it is likely that future studies in this area (this is one of the first published) may provide accurate numbers for the appearance of human populations in different areas of the world and a lower limit to the date of appearance of modern humans.

The nail in the coffin

Therefore, the most accurate date (see note below) for the origin of modern humans indicate that the last common ancestor to modern humans must have existed less than 50,000 years ago (19). Such a recent date left only one potential ancestor for modern humans, that is, Homo neandertalensis (Neanderthals), which lived between 400,000 and 28,000 years ago. Previous anatomical studies had cast doubt on the possibility of Neanderthals being the ancestors of modern humans (23-26). These studies showed differences in Neanderthal's brain case (23) and the presence of an internal nasal margin, a medial swelling of the lateral nasal wall, and a lack of an ossified roof over the lacrimal groove (24-25). None of these features are found in Homo Sapiens, and the last feature is not found in any other terrestrial mammal! Neanderthals had a huge nasal cavity coupled with a brain size larger than our own. However, with their carnivorous lifestyle, it seems likely that much of their brain might have been devoted to the sense of smell, being the "dog" among the hominids.

In brilliantly designed and executed independent studies, scientists have extracted mtDNA from three Neanderthal skeletons; one from Neander Valley in Germany, another from the northern Caucasus near the Black Sea, and the third in Vindija Cave, Croatia, and laid to rest any question of whether Neanderthals could have been our ancestors (27, 28, 29). The first study examined a 397 base pair Neanderthal mtDNA fragment and compared it with a mtDNA sequence of 986 nucleotide pairs from living humans of diverse ethnic backgrounds. The results (Table 1) showed an enormous 26 nucleotide base pair difference between the Neanderthal and Human mtDNA (a 6.5% difference) (30). In this region of the mtDNA, modern humans differ from one another in an average of eight base pairs, and those differences were completely independent of the 26 observed for the Neanderthal fossil. However, many of the sequence variations found in the Neanderthals were shared in the Chimpanzee. A 357 base pair sequence of mtDNA was examined from the second Neanderthal fossil and was found to vary from modern human sequences at 23 bases (6.4%), nineteen of which were identical to those of the first Neanderthal. The third Neanderthal differed from modern humans by 26 bases, 23 of which matched the first Neanderthal and 20 of which matched the second specimen. A summary of the findings of the two studies can be found in Table 1, below.

Table 1. Sequence Differences* Between Modern Humans and Neanderthals

mtDNA Sample
(HVR-1)

Sequence Number (Read Down)
111111111111111111111111111111111
666666666666666666666666666666666
000011111111111112222222222223333
378900112345568880233455666791246
786378129984692399304468123891042

Modern Human AATTCCCCGACTGCAATTCACGCACC-CATCCT
Chimpanzee ......T.ATT.....ACTGAAA.....G....
Neanderthal #1 GG.CTTTTATTC.T.CCCTGTAAG.TATGCT.C
Neanderthal #2  .C.....ATT.ATCCCCTGTAA..TATGCTTC
Neanderthal #3 GG......ATTC.TCCCCTGTAAG.TATGCT.C
*mtDNA HVR-1

The analysis of the second sample was extremely important, since it was dated at 29,000 years ago - only 1000 years before the last Neanderthal disappeared (31). If Neanderthals and humans had interbred, one should have expected to see this in the last remnants of the Neanderthals. In addition, since the Neanderthal fossils were separated geographically by over 2,500 km, it shows that Neanderthals were a homogeneous species. The researchers conclusion: "Neanderthals were not our ancestors" - a quote from the authors of the first study. In fact, the differences between modern humans and Neanderthals were so great that calculations indicated that the last common ancestor (according to evolutionary theory) must have existed 550,000 to 690,000 years ago (first study) and 365,000 to 853,000 years ago (second study).

Although the differences between modern humans and Neanderthals are large, the differences among individual humans or among individual Neanderthals is small compared to other apes (Table 2). Such low genetic diversity among Neanderthals are consistent with a creation model in which Neanderthals were specially created as a small population in the relatively recent past. The much larger variation seen among chimpanzees and gorillas does not eliminate them as specially created, but does place their probable creation date considerably before that of modern humans.

Table 2. mtDNA Sequence Variation Among Species (29)
Population Individuals Mean Minimum Maximum s.d.
Neanderthals 0,003 03.73 - - -
Humans 5,530 03.43 0.00 10.16 1.21
Chimpanzees  0,359 14.81 0.00 29.06 5.70
Gorillas 0,028 18.57 0.40 28.79 5.26

Ancient Anatomically Modern Humans - the missing evidence

Knowing the variation of sequences between modern humans and Neanderthals is important in determining if Neanderthals contributed to the human gene pool. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first of these studies was published in 2001, examining the mtDNA sequences of 10 ancient Australians (32). A summary of the HVR-1 sequence of these individuals (compared with the modern human reference sequence, modern Aboriginal polymorphism, Neanderthals, and chimpanzees) can be found in Table 3, below. The first thing that one notices is that the sequence variation of ancient humans compared to modern humans is at most 10 base pairs (in LM3, the most ancient specimen). As stated previously, the average variation among population groups of modern humans is 8 base pairs. LM3, dated at 62,000 years old, varied the most from the modern human reference sequence, but this variation included only three bases shared with Neanderthal specimens. Since LM3 was a contemporary (or lived even earlier than the Neanderthals sequenced to date), it is apparent that the human genome was already nearly "modern" before Neanderthals died out. The authors of the study made a big deal about the LM3 sequence sharing similarity to a portion of chromosome 11 in modern humans (thought to have been inserted into the human genome from the mtDNA). The authors concluded that the "loss" of the ancient mtDNA variation seen in LM3 could explain how Neanderthals do not share mtDNA with modern humans. Although it is certainly possible that part of mtDNA might find its way into the nuclear genome, it doesn't address the issue of how the variation seen in the mtDNA of LM3 was "lost." In fact, of the ten sequence differences between LM3 and the modern human reference sequence, five of those bases correspond to polymorphisms found in modern Aboriginal people, showing that those five bases were not lost at all. This leaves only a five base difference, certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 60,000 years stands in sharp contrast to the large differences seen between modern humans and Neanderthals. European evolutionists have also disputed the claims of Adcock et al. in the journal Science in June, 2001. More information on this can be found in the paper, New DNA Evidence Supports Multiregional Evolutionary Model?

Table 3. mtDNA Sequence Variation of Ancient, Anatomically Modern Humans (32)
mtDNA Sample
(HVR-1)
Age
(ka)

Sequence Number (Read Down)
00111111111111111222222222222222222222222222233333333333333
79001122345668889001223344444555566677888899901112345556688
83781269984393499198340413479368923448467803911780715672817

Modern Human 0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA
Aboriginal 0 ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...
Bonobo 0 ......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC..
Chimpanzee 0 ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..
Neanderthal #1 30+ GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...
LM3 62 ....................T.G...........CT.T....T..T......TC....G
LM4 <10 .................T...........G................C............
LM15 0.2 ....................T........................T.......C....G
LM55 <10 ...........G.......................T.......................
KS1 10 .C............T.....T.........................CG..T........
KS7 8 ..............T.....T..................T...........C.......
KS8 8-15 ....................T.G..............TG.......C............
KS9 9 .C..................T..............T............C.........G
KS13 8-15 .C............T.....T....C.G.................TC............
KS16 9-15 ....................T...................T.............C..C.
*mtDNA HVR-1

 

The bottom line

There are two currently popular theories of human evolution 1) a single recent appearance of modern humans and 2) the multiregional model, which states that modern humans evolved simultaneously on different continents. Molecular biology destroys the multiregional model (12-22, 27-32). In addition, even the fossil evidence does not support the multiregional model (33). Instead, all the data supports the biblical view that humanity arose in one geographical locale. Modern molecular biology tells us that modern humans arose less than 100,000 years ago (confirmed by three independent techniques), and most likely, less than 50,000 years ago (12-22). This data ties in quite well with the fossil record. Sophisticated works of art first appear in the fossil record about 40,000-50,000 years ago (34) and evidence of religious expression appears only 25,000-50,000 years ago (35, 36). Other indications of rapid changes during the Middle-Upper Paleolithic transition (35, 000 to 45, 000 years ago) in Europe include (37):

Simultaneous, rapid changes in human abilities suggest replacement of previously existing hominids with modern humans. The fact that all these events happened ~50,000 years ago precludes any possibility that previously existing hominids could be our ancestors, since Homo erectus died out 300,000 years ago, and Homo neandertalensis has been proven to be too genetically different from us to have been our ancestor (27, 28). Where does this leave the evolutionists and their descent of man theory? Well, they can always fall back on their favorite line - "the fossil record is just incomplete." Alternatively, check out Genesis 1:26.


References

  1. R. Lewontin 1972. The apportionment of human diversity. Evolutionary Biology 6: 381-398
  2. M. Nei and A. K. Roychoudhury. 1982. Genetic relationship and evolution of human races. Evolutionary Biology 14: 1-59
  3. Janczewski DN. Goldman D. O'Brien SJ. 1990. Molecular genetic divergence of orangutan (Pongo pygmaeus) subspecies based on isozyme and two-dimensional gel electrophoresis. Journal of Heredity 81: 375-387
  4. Gibbons, A. 1995. The mystery of humanity's missing mutations. Science 267: 35-36.
  5. Pult I, Sajantila A, Simanainen J, Georgiev O, Schaffner W, Paabo S. 1994. Mitochondrial DNA sequences from Switzerland reveal striking homogeneity of European populations. Biol Chem Hoppe Seyler 375: 837-840
  6. Wood B. 1992. Origin and evolution of the genus Homo. Nature 355: 783-790.
  7. Shreeve, J. 1996. New skeleton gives path from trees to ground an odd turn. Science 272: 654
  8. McHenry H.M. 1994. Body size and proportions in early hominids. Proceedings of the National Academy of Sciences of the United States of America 91: 6780-6786.
  9. Dean Falk. 1998. Hominid brain evolution: looks can be deceiving. Science 280: 1714
  10. Conroy, G.C., G.W. Weber, H. Seidler, P.V. Tobias, A. Kane, and B. Brunsden. 1998. Endocranial capacity in an early hominid cranium from Sterkfontein, South Africa. Science 280: 1730-1731.
  11. Eyre-Walker, A. & Keightley, P. D. 1999. High genomic deleterious mutation rates in hominids. Nature 397, 344-347.
  12. R.L. Cann, M. Stoneking, A.C. Wilson. 1987. Mitochondrial DNA and human evolution. Nature 325: 31.
  13. L. Vigilant, M. Stoneking, A.C. Harpending, K. Hawkes, A.C. Wilson. 1991. African populations and the evolution of human mitochondrial DNA. Science 253: 1503.
  14. M. Hasegawa, S. Horai. 1991. Time of the deepest root for polymorphism in human mitochondrial DNA. J. Mol. Evol. 32: 37.
  15. Stoneking M, Sherry ST, Redd AJ, Vigilant L. 1992. New approaches to dating suggest a recent age for the human mtDNA ancestor. Philos. Trans. R. Soc. Lond. B Biol. Sci. 337: 167-175.
  16. S. Paabo. 1995. The Y chromosome and the origin of all of us (men). Science 268: 1141.
  17. R.L. Dorit, H. Akashi, W. Gilbert. 1995. Absence of polymorphism at the ZFY locus on the human Y chromosome. Science 268: 1183.
  18. Hammer, M.F. 1995. A recent common ancestry for human Y chromosomes. Nature 378: 376-378.
  19. Whitfield, L.S., J.E. Suston, and P.N. Goodfellow. 1995. Sequence variation of the human Y chromosome. Nature 378: 379-380.
  20. Tishkoff, S.A., E. Dietzsch, W. Speed, A.J. Pakstis, J.R. Kidd, K. Cheung, B. Bonn-Tamir, A.S. Santachiara-Benerecetti, P. Moral, M. Krings, S. Paabo, E. Watson, N. Risch, T. Jenkins, and K.K. Kidd. 1996. Global patterns of linkage disequilibrium at the CD4 locus and modern human origins. Science 271: 1380-1387.
  21. Fischman, J. 1996. Evidence mounts for our African origins - and alternatives. Science 271: 1364.
  22. G. and B. Rannala. 1998. Using rare mutations to estimate population divergence times: A maximum likelihood approach. Proceedings of the National Academy of Science USA 95: 15452-15457.
  23. Seidler H, Falk D, Stringer C, Wilfing H, Muller GB, zur Nedden D, Weber GW, Reicheis W, and Arsuaga JL. 1997. A comparative study of stereolithographically modeled skulls of Petralona and Broken Hill: implications for future studies of middle Pleistocene hominid evolution. J. Hum. Evol. 33:691-703.
  24. Schwartz, J.A. and I. Tattersall. 1996. Significance of some previously unaccompanied apomorphies in the nasal region of Homo neandertalensis. Proceedings of the National Academy of Science USA 93: 10852-10854.
  25. Laitman, J.T.,  J.S. Reidenberg, S. Marquez, and P. J. Gannon. 1996. What the nose knows: New understandings of Neanderthal upper respiratory tract specializations. Proceedings of the National Academy of Science USA 93: 10543-10545.
  26. Holden, C. 1999. A New Look Into Neandertals' Noses. Science 285: 31-33.
  27. Krings, M., A. Stone, R. W. Schmitz, H. Krainitzki, M. Stoneking, and S. Paabo. 1997. Neandertal DNA Sequences and the Origin of Modern Humans. Cell 90: 19-30.
  28. Igor V. Ovchinnikov, I.V., A. Gotherstrom, G. P. Romanovak, V. M. Kharitonov, K. Liden, and W. Goodwin. 2000. Molecular analysis of Neanderthal DNA from the northern Caucasus. Nature 404: 490-493.
  29. Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. Grossschmidt, G. Possnert, M. Paunovic, and S. P””bo. 2000. A view of Neandertal genetic diversity Nature Genetics 26: 144-146.
  30. Arnason, U., X. Xu, and A.Gullberg. 1996. Comparison between the complete mitochondrial DNA sequences of Homo and the common chimpanzee based on nonchimeric sequences. J. Mol. Evol. 42: 145-52.
  31. Stringer, C. B. and R. Mackie. 1996. African Exodus: the Origin of Modern Humanity. Cape, London.
  32. Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne. 2001. Mitochondrial DNA sequences in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: 537-542
  33. Foley R. 1998. The context of human genetic evolution. Genome Res 8:339-347.
  34. Klein, R.G. 1992. Evolutionary Anthropology 1: 5-14.
    Balter, M. 1999. Restorers reveal 28,000-year-old artworks. Science 283: 1835.
  35. Simon, C. 1981. Stone-age sanctuary, oldest known shrine, discovered in Spain. Science News 120: 357.
  36. Bower, B. 1986. When the human spirit soared. Science News 130: 378-379.
  37. Clark, G.A. 1999. Highly visible, curiously intangible. Science 283: 2029-2032.

Note:
The 50,000 year date is the best estimate for modern human origins because the study used a much larger nucleotide base pair sample size, resulting in a much less uncertainty in the date generated (see the table below for further explanation).

  95% confidence interval  
Study Model # base pairs # men Total base pairs Lower Upper Mean Male population size
Dorit, et al. Coalescent 729 38 27702 0 800,000 270,000 7,500
Dorit, et al. Star phylogeny 729 38 27702 0 80,000 27,000 7,500
Hammer Coalescent 2,600 15 39,000 51,000 411,000 188,000 5,000
Whitfield, et al. Coalescent 18,300 5 91,500 37,000 49,000 43,000 not given
The estimate of modern origins is highly dependent upon the assumed population size (last column of table). The first study assumed a male population size of 7,500 individuals for the entire period of humanity (excluding the last couple thousand years, of course). Such a population size, according to the authors, is "an exceedingly small population size for this entire 300,000 year period" (16). However, such as small population size was necessary to make the coalescence time as large as it was. Hammer used an even smaller population size (5,000), since he was concerned that his study would not be accepted if the coalescence time was too small (which he admitted to doing in Internet dialogs). The first two studies (Dorit, et al. and Hammer) have very large confidence intervals, due to the small number of nucleotide base pairs analyzed. Given the size of the confidence intervals in the first two studies, the numbers from all three studies are basically the same. Obviously, the Whitfield, et al. gives the most precise estimate of the date for the appearance of modern humans.

Home | Apologetics | Answers | Love | Slideshow | Evolution/Design | Discussion
Personal | Webmaster | General | Doctrine | Cults | Discovery | Young-Earth | Search

Last updated 06/22/01


Kind of long, but hard science often is. I understnad there has been some questioning of mtDNA analysis, but the youngest dates for common origin in this article are from Y-chromosome studies.

I wonder if the questioning of mtDNA is because it is not finding what the establishment thought is should find?

1 Posted on 07/07/2001 20:47:05 PDT by Ahban
[ Reply | Private Reply | Top | Last ]


To: Ahban

Thanks for posting the article. I am just reading a new book "Mere Creation" editd by Dempski, which deals on a scientific basis with many of the problems of the evolutionist (anti-theistic naturalistic) hypotheses, and will check out the website you referenced above. I just love the statistical and logicalproofs that evolutionism is nothing more than an unsupportable metaphysical stance.

2 Posted on 07/07/2001 21:15:57 PDT by wildandcrazyrussian
[ Reply | Private Reply | To 1 | Top | Last ]


To: wildandcrazyrussian

I have also noticed that our evo friends on this site are extremely skiddish about numbers.

My take: The ground rules they want are."If we can even conceive of a way that it might have happened, then you must agree that it HAD to have happened that way. We don't have to demonstrate it. If we can imagine it then you must accept it as fact. If you don't, then you are an ignorant flat-Earth rube. And also, no calculating odds or estimating allowed! Of course, we are allowed to say the we are 100% certain that it happened."

What does it say when numerical analysis of claims is met with such reluctance and even hostility?

3 Posted on 07/07/2001 21:28:47 PDT by Ahban
[ Reply | Private Reply | To 2 | Top | Last ]


To: Ahban

Man has devolved. Adam and Eve where in the perfect image and likeness of God before they took the devil's advice. The good news is "all that was lost in Adam will be regained through Christ". The absolute healthiest, wealthiest, and wisest man on this plane is a pile of steaming dung compared to a man in God's eternal image and likeness. Just ask Solomon, who had it ALL, as far as ALL will get you in this world. And he said "ALL is vanity and vexation of spirit." Life doesn't even begin until we regain what was lost in Eden. Then we won't have to listen to all this convolution, evolution, devolution, etc, etc. When you have the mind of God you will know the truth about EVERYTHING!!!!!

4 Posted on 07/07/2001 21:43:22 PDT by Russell Scott
[ Reply | Private Reply | To 1 | Top | Last ]


To: Ahban

You are going to be a lonely man Ahban. The regular evolutionist defenders are Christian bashers not scientists. If any of them come over to debate, why I'll have to call Jed and say "Whee doggie!"

5 Posted on 07/07/2001 22:29:18 PDT by peg the prophet
[ Reply | Private Reply | To 1 | Top | Last ]


To: peg the prophet, Ahban, wildandcrazyrussian

Awesome information! The more that is disproved, the better. It's called the process of elimination. This research will help scientists worldwide in their search to discover the origins of life.

I'll leave it up to the molecular biologists to debate it, I believe in evolution over creationism based on faith alone.

6 Posted on 07/07/2001 22:47:44 PDT by Cap&Ball
[ Reply | Private Reply | To 5 | Top | Last ]


To: Cap&Ball

Nice to see you, Cap&Ball!

BTW, if you ever get bored with 'faith alone,' check out Intelligent Design. No faith required, just a willingness to look at hard evidence.

7 Posted on 07/07/2001 23:21:00 PDT by Bonaparte
[ Reply | Private Reply | To 6 | Top | Last ]


To: Bonaparte

Hey B! I checked out all the links you kindly provided. Very interesting stuff. All good food for thought, thanks again.

When I say origin of life, I mean origin of life. Faith alone tells me it had to start somewhere. If not from here then surly from somewhere else. Let the research continue, science will never answer all questions, but it creeps forward.

8 Posted on 07/07/2001 23:35:00 PDT by Cap&Ball
[ Reply | Private Reply | To 7 | Top | Last ]


To: wildandcrazyrussian

Glad to hear you're enjoying Mere Creation. If you haven't done so already, read his Intelligent Design next, and then read this.

9 Posted on 07/07/2001 23:39:26 PDT by Bonaparte
[ Reply | Private Reply | To 2 | Top | Last ]


To: Bonaparte

On my list. thx

10 Posted on 07/07/2001 23:48:33 PDT by Cap&Ball
[ Reply | Private Reply | To 9 | Top | Last ]


To: Ahban


I am both a Christian and a scientist. That paper is very, very misleading in many parts. That is indisputable.

For instance, Man did not develop equally throughout the world. In the 1400s, most people in what is now the United States were still in the stone age. Some people in different areas of the world are still in the stone age today, and many others would still be if we had left them alone.

Sumer was "civilized" long before anyplace in Africa. Later, so was Babylonia, then Egypt. There is also evidence of civilization in what we now call Russia and Poland about the time Sumer was starting. Areas in South America had major cities developed when the Egyptian dynasties were developing. None of this is very compatible with the "out of Africa" theory.

Today, we live in a touchy-feely world where diversity is supposed to rein supreme and all of the world's people are supposed to be equal. But, as a research physiologist for many years, I can tell you that we are far from the same. Not only do we differ due to point of origin, we even differ within our own families. We might be equal under the law, but we are most certainly not equal physiologically -- nor anatomically. No more than different breeds of dogs or monkeys are, anyway. And how in the world did monkeys develop on different continents, oceans apart?

At this time, there is no one who can document how and where modern man developed. If you wish to put a religious spin on it, then at least admit that Geneses in the Bible is but the Cliff's Notes version of what really happened. That is, it tracks right along with the original version, just leaves parts out and transcribes a few words incorrectly. Only those who read ancient Hebrew perfectly can understand that part of the Bible accurately. And, those who are able to read that ancient Sumerian tablets correctly can understand the whole of the story that Geneses was written from.

These writings are available to us. But, few religious leaders know how to read the languages. Therefore, most people still rely on a third or fourth hand translation of the Old Testament.

Science is not far from The Word in Geneses -- as it was originally written. And if one believes science is wrong, than one must also be knowledgeable enough to describe exactly how long a day is in the life of God.

Hearing no answer for that, I think I will stick with the meaning of the original words, as written, in Geneses -- not how they are now sometimes stated to mean after multiple translations.

After all, if the Bible is The Word of God, we must also admit that The Word was originally written in ancient Hebrew (and Geneses in Sumerian first) and so the original meaning of those words must be how we are intended to understand The Word. Which means, we must stop fooling around with second and third hand information.

I cannot see how this can be explained any other way. There is a major disparity between the original meaning of the ancient Hebrew text of Geneses and how some people relate it now. We either use the original text, or we are making things up as we go along.

I'm very sorry if that is inconvenient. Nonetheless, it is the way I see this argument as it unfolds today.


11 Posted on 07/08/2001 00:16:20 PDT by Doug Fiedor
[ Reply | Private Reply | To 1 | Top | Last ]


To: Doug Fiedor

Studying the various translations of the Bible is an avocation of mine. (I am also a Christian and a scientist, and my training as the latter allows me to pick my way through Greek, and I regularly go that far back in my Biblical studies.) It is disturbing to see how many substantial and fundamental variations have crept in over the centuries. Some of these variations have occurred to "modernize" and make accessible the ancient texts. Some have occurred to make it more politically correct in the era of the translation or less offensive or challenging to the benefactors of the translation. Some of the changes were the result of philosophical re-interpretation, varying from well-meaning to corrupt to outright Satanic in motivation (and many of the earliest Gnostical manipulations of the text fall into that last category, IMHO). And many of the changes made things shorter.

And that's just the New Testament. I don't read Hebrew, so I can only assume that the same has occurred to an even larger degree over the much longer timeframe that the Old Testament has been with us, and that the Old Testament we read today differs even more from the original full-text.

Ask yourself this: Why would the fabled Ark of the Covenant be so treasured an artifact over so many generations? Is it merely its rarity... or might it be that its contents differ siginificantly (perhaps dangerously) from the common-man's Old Testament-- and perhaps are much more complete, perhaps even shatteringly so?

Certainly your thesis that there's more to the Old Testament than survives in today's common translations has got to be correct. There is no way that the Old Testament has not suffered the same "helpful" and corrupting forces as have polluted the latter-day versions of the New Testament over the eons.

In any case, the thesis that all men are not necessarily equal is true, too. I would love to have Michael Jordan's talents, but I don't. I have my own gifts, as do you, as does everyone who reads this. We are not equal, any more than a dachshund is equal to a Great Dane. Both have their superiorities in certain senses. What we have is equal opportunity to use our gifts and to seek the Truth, and, nominally today, equal rights which were given to us by God (despite the conceits of the likes of Bill Clinton). And, of course, it is incumbent upon each of us to treat each other with equal initial respect.

As to the difficulties posed to the Out-of-Africa notion, Jesus himself said that he had sheep in "other folds" that we know nothing of. What this means is a mystery to us, and there are many interpretations today. Some sects have claimed this phrase for their own purposes, for example to legitimize claims that Jesus visited their earliest tribes bodily; others point to this phrase to support their conjectures of life on other planets or other planes. In any case, the fact that civilization sprang up simultaneously around Earth remains an inconvenient fact for those who prefer a lineal view of history and human advancement. Clearly, something "turned on" among many of our divergent brethren at about the same time. But, as you point out, not all. The why of that remains mysterious... and fascinating.

12 Posted on 07/08/2001 04:55:31 PDT by RightOnTheLeftCoast
[ Reply | Private Reply | To 11 | Top | Last ]


To: Ahban

It takes more faith to believe in the "descent of man" theory (evolution) than it does to believe in a Creator.

13 Posted on 07/08/2001 05:21:10 PDT by GuillermoX
[ Reply | Private Reply | To 1 | Top | Last ]


To: Doug Fiedor

I am both a Christian and a scientist. That paper is very, very misleading in many parts. That is indisputable. For instance, Man did not develop equally throughout the world. In the 1400s, most people in what is now the United States were still in the stone age. Some people in different areas of the world are still in the stone age today, and many others would still be if we had left them alone

Good morning Doug. I'd like your take on the GENETIC aspects of the study. That is really what this study is about. It is true that TECHNOLOGICALLY man did not develop all at once, but I beleive the focus of the report is the GENETIC development of man. Those few tangendental comments relating to civilization were made outside the author's field of expertise. At least that is my read

I also beleive the Word of God is Divinely inspired but that does not mean it is always Divinely interpreted!

Have you seen the interpretation of Genesis One that I sometimes post? It ties Scientific observation in quite well with a literal Day-age interpretation of Genesis One.

You seem to know something about archeology, so I hope you have heard about the Elba tablets. They are six centuries older than the oldest known Summerian accounts of "The Flood Story". The Elba tablets version is closer to the Genesis version than the Sumerian account.

14 Posted on 07/08/2001 06:08:52 PDT by Ahban
[ Reply | Private Reply | To 11 | Top | Last ]


To: peg the prophet VadeRetro Godel dbbeebs Physicist PatrickHenry jennyp

You are going to be a lonely man Ahban. The regular evolutionist defenders are Christian bashers not scientists. If any of them come over to debate, why I'll have to call Jed and say "Whee doggie!"

Perhaps so Peg, but I'll flag them just the same.

Then I'll duck!

15 Posted on 07/08/2001 06:12:36 PDT by Ahban
[ Reply | Private Reply | To 5 | Top | Last ]


To: Ahban

As some others have said, a very misleading selective assembly of data points. And a lot of those "nails" have just come out of the coffin:

Forget all those mtDNA studies.

It is probably true nevertheless that there has been a genetic bottleneck in "recent" human history, back in the Pleistocene. Well, times were tough. Cheetahs went through such a tiny bottleneck somewhere back then that they can still give each other skin grafts today. That doesn't help make a case against evolution that I can see. It's all perfectly lawful behavior. You can go extinct. You can go to the brink and come back. If the latter happens, it will take some time to re-establish genetic diversity.

16 Posted on 07/08/2001 06:30:00 PDT by VadeRetro
[ Reply | Private Reply | To 1 | Top | Last ]


To: VadeRetro

Whoa! Let's not throw the baby out with the bathwater. mtDNA still has its uses. It may not be so good when comparing the relatedness of animals from different classes (perhaps because there IS NO relatedness!), but no study has even implied that it is not a valid tool for measuring genetic diversity within a species or closely related group.

Besides that, the study that shows the LOWEST mean date did not use mtDNA. It used y-Chromo.

OK Vade, you say there was a bottle neck. Fair enough. I think there was too, depending on how the Flood Account is interpreted. Tell me though, how recent does the common ancestor of all living humans have to be before you start getting uncomfortable with evolution as the explanation? 100,000 years? 80,000? The evidence suggests it was more recent than that. 70,000 years? How about what these studies suggest, 40-50,000 years? Notice even that figure uses an unreasonably small total poulation sample size. A more reasonable estimate would push the date up even further.

If the common ancestor date was much beyond 70K years, I would feel uncomfortable with my creationist viewpoint. (bear in mind I think it is less than this, but there was an event, the Vela SuperNova, that could have increased mutation rates for thousands of years and given a false appearance of age to a species created less than 70K ago.)

How recent would the date have to be before you become uncomfortable with your evolutionist viewpoint on human origins? Please give a number.

17 Posted on 07/08/2001 08:27:20 PDT by Ahban
[ Reply | Private Reply | To 16 | Top | Last ]


To: Ahban

From the last paragraph of the article:

Simultaneous, rapid changes in human abilities suggest replacement of previously existing hominids with modern humans. The fact that all these events happened ~50,000 years ago precludes any possibility that previously existing hominids could be our ancestors, since Homo erectus died out 300,000 years ago, and Homo neandertalensis has been proven to be too genetically different from us to have been our ancestor (27, 28). Where does this leave the evolutionists and their descent of man theory? Well, they can always fall back on their favorite line - "the fossil record is just incomplete."

Very interesting. I don't think anyone disputes the appearance of our species around 50,000 years ago. It could be earlier, but that would require a finding of earlier fossils. And it also seems to be true that we're not descended from the neanderthal. Fine. Now what? Do we fall back on what our parents told us and believe that the stork brought us? The author wisely ignores that explanation, yet he would have us believe that we miraculously "poofed" into existence, with no ancestral line. He concludes this because the neanderthal is ruled out. I respectfully suggest that the universe of possibilities is greater than this artificial "neanderthal or Genesis" dichotomy. Indeed, although the article sneers at it as an "excuse", we all understand that the fossil record is incomplete. It will never be complete. But that doesn't prove the "poof" conjecture.

18 Posted on 07/08/2001 08:40:33 PDT by PatrickHenry
[ Reply | Private Reply | To 1 | Top | Last ]


To: Ahban

I believe you are confusing the origin of a species with the "last common ancestor" measurement resulting from the bottleneck effect. That's a limitation of molecular clocking for such fine-grained applications.

AFAIK, the appearance date for Homo sapiens sapiens remains at about 120K years ago. What appears about 40K years ago is what was once called "Cro-magnon culture."

19 Posted on 07/08/2001 09:15:35 PDT by VadeRetro
[ Reply | Private Reply | To 17 | Top | Last ]


To: Ahban

Modern molecular biology tells us that modern humans arose less than 100,000 years ago (confirmed by three independent techniques), ...

This claim isn't supported by the results reported in the article. The age of the last common male ancestor of men alive is a very different thing from the origin of modern humans as is the age of the last common female ancestor of us all. OTOH, I think it'd be fair to conclude that the 200K year age of the last common female would establish a lower bound on the age of modern humans.

Also, doesn't the recentness of these last common ancestors at least partly explain the relative genetic homogeneity of modern humans?

20 Posted on 07/08/2001 09:55:16 PDT by edsheppa
[ Reply | Private Reply | To 1 | Top | Last ]


To: wildandcrazyrussian

I am just reading a new book "Mere Creation" ...

I read it a while back. One particularly appalling entry is the woman lawyer who's positive that evolution has become the leading explanation due to politics and not science. She implicitly advocates a similar program for creationism.

21 Posted on 07/08/2001 09:59:16 PDT by edsheppa
[ Reply | Private Reply | To 2 | Top | Last ]


To: Doug Fiedor, RightOnTheLeftCoast, peg the prophet,logos, Ahban

There were three things listed as *in the Ark of the Covenant*: the tablets of stone (commandments from the mount), Aaron's rod that budded, and a container (ephod, I think) of manna. If the tablets of stone were to be found and read, the succinct nature of God's writing would blow away human foolishness; the written language used to record the tablet commandments is believed to be what ...?

As to Sumerian writing, the library of Ashurbanipal, lost in the destruction of Ninevah in 612 BC, contained the recounting of Sumerian tales, important ones of which were those regarding Gilgamesh and his epic adventure with his friend who found an Edenesque Garden and tree which could give one the lifespan of a God. Legends sometimes have a basis in fact. The Genesis account of Eden contains many clues not found in the cuneiform texts from Ninevah, not the least of which is a guard set to protect entry to the tree portion of the Garden, as if the tree of life would not die.

Why bring this up? ... Because the game of seeking earliest texts from which to read and substantiate the Bible is a futile study until and if the original words from God as written in the stone tablets are found by humankind. The exercise is and was designed from the outset to be one of faith, not evidentary accumulation.

All the studies in evolution appear to disregard the very real possibility that we humans (and perhaps many of our animal cousins) are changing on levels of reality not evidenced by fiossils, per se ... evolution may be the process God uses and the soul and spirit are likely to be evolving also, if the bodily vehicles are evolving. The issue of time transcendence is important to the concept of abortion v creationism, but no one ever addresses it, kind of like the large simian in the corner that no one wants to arouse.

22 Posted on 07/08/2001 10:26:11 PDT by MHGinTN
[ Reply | Private Reply | To 12 | Top | Last ]


To: VadeRetro edsheppa

AFAIK, the appearance date for Homo sapiens sapiens remains at about 120K years ago. What appears about 40K years ago is what was once called "Cro-magnon culture."

Your link claims that, but I have seen photos of the handful of "modern" human finds that are older than 50K. There are a couple they date to 120K and one they GUESS is around 80K. I have seen the photos of the actual fossils. They do not look like "modern humans" to me. Bigger photos, or even better, holding an exact model of the fossils in our hands, would make the differences more obvious, I should think.

Besides all that, every trace of art, ornamentation, religion, and culture are missing from all "modern human" finds older than 50K. Not everything that ever walked on two legs and had a large brain was a human. Nor was it necessarily our ancestor. What makes us different from other hominids are exactly those things that only show up about 40K ago. Those things show up suddenly. There is no gradual development. The earliest cave art we can find is as good as a typical college freshman art student could do today, given the same materials.

The time between 50K and a few million years ago is a "radioactive dating" gap. It is too old for C-14 accuracy and too young for potassium argon and the like. Do you know of a method that is reliable for that region?

So I take it that both of you hold to the Bibical idea that there was a near extinction of the human race in the distant past? Is it your position that mankind separated from a common ancestor 300-500K ago (when such common ancestors were around), and then nearly went extinct less than 100K ago?

PS- I'd still like that number. How recent an age would be needed for the common ancestor of all humans to make you reconsider the evolutionary hypothesis (for the origin of man)?

23 Posted on 07/08/2001 10:44:41 PDT by Ahban
[ Reply | Private Reply | To 19 | Top | Last ]


To: Ahban

How recent an age would be needed for the common ancestor of all humans to make you reconsider the evolutionary hypothesis (for the origin of man)?

Permit me to clear away some underbrush which is blocking our path.

First, everything now living has an unbroken chain of ancestors, going back to the very beginnings of life (whenever that was).
Second, fossils are rare, and not easy to find. There are gaps in the fossil record and there will probably always be gaps.
Third, we can't agree, today, on modern man's immediate ancestry.
Fourth, there are loads of people today, possibly right here on these threads, who don't know and will never know who their parents or grandparents were. Yet -- and this is important -- we assume that such ancestors existed. No storks. No miracles.

Okay, hypothetical question here. Let us imagine that we shall never locate a fossil of modern man's immediate ancestor. What conclusions flow from this? (a) Genesis is word-for-word true? or (b) We just don't know all we'd like to know about our ancestry.

24 Posted on 07/08/2001 11:02:14 PDT by PatrickHenry
[ Reply | Private Reply | To 23 | Top | Last ]


To: Ahban

Those things show up suddenly. There is no gradual development.

Excuse me, but you just threw out all the gradual development by insisting on fully, fully modern when you said, "They do not look like 'modern humans' to me. . . Not everything that ever walked on two legs and had a large brain was a human."

The earliest cave art we can find is as good as a typical college freshman art student could do today, given the same materials.

I don't know all the dates but there's lots of kindergarten-level rock art. It doesn't prove anything one way or the other to me. All the rock art is apparently recent enough to be anatomically modern. Fine.

The time between 50K and a few million years ago is a "radioactive dating" gap. It is too old for C-14 accuracy and too young for potassium argon and the like. Do you know of a method that is reliable for that region?

There could be a better fit, but Chlorine-Argon might be workable. Your 50K is a reasonable 1/6 of the half-life involved. Are you grasping at straws?

PS- I'd still like that number. How recent an age would be needed for the common ancestor of all humans to make you reconsider the evolutionary hypothesis (for the origin of man)?

There's more than just someone citing a recent number. We'd have to undiscover or toss out most of the evidence we have already. I don't see that as likely. By contrast, you've already done that with creationist data filters. If I don't like it, it's a conspiracy.

Does it depend upon what you mean by "modern?" That link we just discussed said there's evidence we're still evolving under new pressures. It's gradual change. Even a punk eek scenario is maybe 50K years.

We may indeed have changed a little over the last 40K years, almost certainly over the last 100K years, but the changes over that time aren't that big. We already have a better hominid sequence than your question presumes. If it turned out we came from nowhere 40K years ago, that would shake me. But I already know that's not true.

25 Posted on 07/08/2001 11:41:34 PDT by VadeRetro
[ Reply | Private Reply | To 23 | Top | Last ]


To: VadeRetro

If it turned out we came from nowhere 40K years ago, that would shake me. But I already know that's not true.

Thank you for answering without me having to badger you.

26 Posted on 07/08/2001 11:51:50 PDT by Ahban
[ Reply | Private Reply | To 25 | Top | Last ]


To: PatrickHenry

Okay, hypothetical question here. Let us imagine that we shall never locate a fossil of modern man's immediate ancestor. What conclusions flow from this? (a) Genesis is word-for-word true? or (b) We just don't know all we'd like to know about our ancestry.

Both conclusions are possible from a LACK of evidence. A lack of such evidence could not decide between A and B. Given that the evidence is lacking, your preference must then be based on your faith, or your a'priori assumptions. Both of us are doing this, so I can hardly fault you for it! I just ask you to give me the same consideration.

Still, FINDING a steady chain of such ancestors with artifacts indicating a slowly developing "cultural" sense WOULD discredit Genesis. So there are ways to NULL our ID hypothesis.

I am having trouble solicting from your side any reasonable circumstances under which your evolutionary hypothesis could be nullified. Which is fine, as long as one admits it is faith-based. All evidence is interpreted in light of a'priori assumptions which are NOT to be questioned. That is even more faith-based than my Genesis convictions, as I allow for the possibility that I may be misinterpreting what God is saying to us through that account.

Lack of evidence is not conclusive proof either way. OTOH, the LACK of evidence does favor A more than B under these circumstances: Situations in which we are reasonably sure that we would have found the missing evidence should it exist. THe more our knowledge grows with the evidence still lacking, the greater the probability that option A is correct, and B is false. For example, we may never find Ms. Levy's body. The fact that we have not found it does not PROVE that she is dead. Still, I maintain from this lack of evidence that she is dead. As time passes and our knowledge grows, we should expect to have found Ms. Levy if she were still alive. The more that time passes and our search grows, the more confident we can be in our conclusions, despite the fact they were made from a LACK of evidence.

Are we there yet in the search for man's allged immediate ancestors? No, we are not. There is lots of room for you to maintain your position with confidence. But the incoming evidence has tilted the scales to the point whee you guys should be willing to at least consider begining to question your absolute certainty of it.

I mean, the evidence could have supported the "muti-regional" hypothesis, but it did not. It supports the "Out of Africa" hypothesis. It could have supported an Out of Africa hypothesis with a common ancestor 400K ago. It does not. I call a "Young Out of Africa" hypothesis the "Garden Hypothesis, since it aligns with Gen 1 pretty well. We could have been close to Neadertal Man, instead we are distant from him, and chimps are close to him.

At some point the evidence might start creeping back your way- it has gone your way for many decades. But I think the recent evidence has all come down in such a way that the "Garden Hypothesis" looks more and more probable, even though absolute proof is elusive. Science is not good with "absolute proof" anyway. Metaphysical certainty is a religious idea. Science deals in probabilities.

27 Posted on 07/08/2001 12:21:11 PDT by Ahban
[ Reply | Private Reply | To 24 | Top | Last ]


To: VadeRetro

If it turned out we came from nowhere 40K years ago, that would shake me. But I already know that's not true.

Ahem! I would express this differently. First, even if no "immediate ancestor" fossil were found, it would not be "proof" that we came from nowhere. It would only mean that we couldn't find a fossil. Perhaps our ancestors were few, and they were bright enough to avoid bogs, so they never became fossils. Good for them; awkward for fossil hunters. (Hey, we couldn't find OJ's murder weapon either, but what does that prove? Only that it's well-hidden.) So we will never have proof that we came from nowhere. Besides, the "default assumption" ought to be that, like everything else, we came from somewhere. Thus, like VadeRetro, I strongly suspect that we didn't come from nowhere. I certainly know that such a scenario can't be proven by the absence of a fossil.

28 Posted on 07/08/2001 12:25:03 PDT by PatrickHenry
[ Reply | Private Reply | To 25 | Top | Last ]


To: Ahban

Whether the humankind now living evolved through millions of years or not isn't really the important question ... Our Creator can take as long as desired to bring into existence a suitable carrier for the really relevant thing, the human spirit ... not the soul, the human spirit, for the human soul may well be derived from the tree which reaches back over the 4+ billion years we believe the earth has been in orbit about the sun.

The advent of spirit into the animal kingdom, in humankind, is the really important issue, and there is scant evidence over which to deabte ... none, by the calculation of some; science would say there is zero evidence to indicate a spirit reality connected to the soul of consciousness. And that is as it should be! We are to evolve the spirit via a force known as faith.

29 Posted on 07/08/2001 12:28:47 PDT by MHGinTN
[ Reply | Private Reply | To 26 | Top | Last ]


To: Ahban

bump!

30 Posted on 07/08/2001 12:31:50 PDT by VOA
[ Reply | Private Reply | To 1 | Top | Last ]


To: Ahban

I am having trouble solicting from your side any reasonable circumstances under which your evolutionary hypothesis could be nullified. Which is fine, as long as one admits it is faith-based. All evidence is interpreted in light of a'priori assumptions which are NOT to be questioned. That is even more faith-based than my Genesis convictions, as I allow for the possibility that I may be misinterpreting what God is saying to us through that account.

No, no. Evolution is easily disproved. VadeRetro has a link to a site with 29 proofs (and possible disproofs) of evolution. He's better at this issue than I am. But in a nutshell, if you find "modern" fossils in the geological record way before they're supposed to have evolved, you've got your disproof of gradual evolution. So evolution, like other sciences, isn't faith-based. It rests on the evidence, as reasonably interpreted. If you have a genuine contradiction, you'll win.

31 Posted on 07/08/2001 12:32:00 PDT by PatrickHenry
[ Reply | Private Reply | To 27 | Top | Last ]


To: Ahban


I hope you have heard about the Elba tablets. They are six centuries older than the oldest known Summerian accounts of "The Flood Story". The Elba tablets version is closer to the Genesis version than the Sumerian account.


How in the world can you say that the Elba tablets predate the writings from early Sumer? At the very least, 30,000 years separate them -- and it could be a great deal more.

Most of those Elba writings are part of the history as "revised and extended" by Marduk (God & ruler) of Babylonia and his followers. He tended to rewrite everything in his favor -- even making himself the creator.

In any case, the Elba tablets are probably only about 4,000 years old. That was a trade route and most of those records deal with marketing. Tell Mardikh (Elba) prospered about 2300 BC. It was soon destroyed by the Mesopotamian King Sargon (or, as some think, his grandson Naram-Sin). The attackers were followers of the Goddess Inanna (also called Ishtar), who was in an ongoing war with Marduk for thousands of years. Their constant bickering was what earlier resulted in the destruction of Sumer.

That area was originally populated mostly by rather uncivilized Semitic people. At the time those tablets were written, the population was writing in the cuneiform characters of the old Sumerians. That is for one simple reason: When Sumer was destroyed, some of the surviving Sumerians migrated to that area and brought along their culture.

Incidentally, in the few years that Tell Mardikh prospered, there were already major civilizations, thousands of years old, in Egypt, South America and Russia. Greece was active, too, come to think of it. Rome was beginning. And some communities dotting around Northern Europe were well into the Bronze Age already.

If you look to the DNA studies for definitive information, you will need to wait a few more years. Current DNA technology is about at the same level of sophistication as the crystal set I made as a Cub Scout is to this notebook computer I am writing on today. In other words, it's very interesting science, but there's a ways to go yet.

Now . . . lets forget about man for a moment . . . tell me about the monkeys. How did monkeys happen to pop up all over the globe? Inconvenient, eh?

32 Posted on 07/08/2001 12:48:29 PDT by Doug Fiedor
[ Reply | Private Reply | To 14 | Top | Last ]


To: PatrickHenry

I have seen some of those proof. I concede the point that I do think evo is science. Vade is good at this. Still, many of those "proofs" are just as much evidence for a common designer as common ancestor. Your example of a fossil in an inappropriate layer would also disprove at least the Day-Age Genesis ID hypothesis that I and others hold. We need some things that really are evidence for the one, that could not just as easily be interpreted for the other. Its not an easy thing.

33 Posted on 07/08/2001 12:50:09 PDT by Ahban
[ Reply | Private Reply | To 31 | Top | Last ]


To: PatrickHenry, Ahban

PH: I certainly know that such a scenario can't be proven by the absence of a fossil.

I have a problem with even pretending that there's no fossil progression for humans. There's a progression. The game here is to throw out everything except the last and say, "But where oh where oh where are the intermediate fossils?" PH, you should know by now that there will never be enough "missing links" found. As soon as you find a missing link, it isn't the missing link.

At risk of repeating myself, this article is a grab-bag of data, misleading by the selection and mischaracterized in the presentation.

The beginning of trouble - lack of genetic diversity among modern humans

There's a worse lack of genetic diversity in cheetahs. It happens. The age of the species may be earlier than the last bottleneck.

Still more trouble - Discontinuous morphological changes in the hominid lineage

Punctuated equilibrium. Is the author uneducated?

Another problem - too many deleterious mutations

See what I mean about a grab bag? Anyway, given what I'll have to say about how the author handles the next topic, I seriously question whether both data and model are accurate.

Recent origin of modern humans confirmed through molecular biology

Most of these studies only tend to confirm the divergence from "last common ancestor," the genetic bottleneck. That the author fails to note this, in fact cites the bottleneck elsewhere as a separate proof and then fails to note what it does to his molecular clock studies looks bad. In his mind, he's dazzling me with footwork.

There's also a heavy reliability upon mtDNA studies, whose reliability have cast the whole "Out of Africa" and "We are not neanderthals" study conclusions in doubt. You have tried to defend mtDNA as still reliable. I don't see how.

But Killian said that mitochondrial DNA provides misleading results for a variety of reasons. Most importantly, it requires more human input to decide which information is fed to the computer, thereby raising the risk of human bias. In fact, when the data were given to three different laboratories for analysis, they generated three different family trees, Killian said.

Secondly, the "bootstrap value" - a measure of the relatedness of genes -- which the computer assigns to the accuracy of its predictions has been quite low in mitochondrial studies on mammalian associations, hovering between 40 percent and 60 percent.

You defend it as perhaps still being useful for small-scale analysis. That's unproven in itself, but it's no good here anyway because it only takes you back to that bottleneck.

Your only "humans-and-apes" Y-chromosome study--the others only measure back to the bottleneck--has 243K years of play in it. Only the bottom end of that range is of any help to you. I am not impressed.

34 Posted on 07/08/2001 13:00:14 PDT by VadeRetro
[ Reply | Private Reply | To 28 | Top | Last ]


To: PatrickHenry, Ahban

You have tried to defend mtDNA as still reliable.

You (Ahban) have tried . . .

Failed to note the shift of address in my post above. Only the first paragraph was to Patrick.

35 Posted on 07/08/2001 13:05:45 PDT by VadeRetro
[ Reply | Private Reply | To 34 | Top | Last ]


To: PatrickHenry

He's better at this issue than I am.

You flatter me. If Kevin Curry is right, we're both journeymen. (He has me there.)

36 Posted on 07/08/2001 13:35:51 PDT by VadeRetro
[ Reply | Private Reply | To 31 | Top | Last ]


To: VadeRetro,PatrickHenry

When I was in school, the debate raged even then, was Neanderthal an immediate ancestor or a failed branch.

37 Posted on 07/08/2001 13:51:52 PDT by RadioAstronomer
[ Reply | Private Reply | To 36 | Top | Last ]


To: Ahban

So I take it that both of you hold to the Bibical idea that there was a near extinction of the human race in the distant past?

Is that the "Biblical idea?" Strange. It doesn't sound like a formulation the literalists would agree to. BTW, why aren't they posting to this thread, ripping the assertions in the article?

As for me, although I said, the 200K year figure for the last common female ancestor seems to establish a minimum age for modern humanity, on second thought it's not so clear. Sharing mtDNA with that female doesn't necessarily imply much sharing of other parts of the genome.

On the question of "nearly went extinct less than 100K ago," that's not clear to me either. Is near extinction required for one female's mtDNA to become fixed over 200K years? I haven't studied this enough to know. Maybe I'll do some reading and thinking.

38 Posted on 07/08/2001 13:58:16 PDT by edsheppa
[ Reply | Private Reply | To 23 | Top | Last ]


To: edsheppa

I was refering to the flood. Maybe the YEC have not seen this thread, or maybe they are more comfortable with someone who shares their core assumptions but differs in the details than they are with those who flatly contradict their core beliefs. Or maybe they are just more open minded! Hehe.

I don't know why you insist on a minimum of 200K for the origin of common human ancestor. Maybe you are only looking at the three columns that give a minimum, maximum and mean. But look over at the population size assumed...

The estimate of modern origins is highly dependent upon the assumed population size (last column of table). The first study assumed a male population size of 7,500 individuals for the entire period of humanity (excluding the last couple thousand years, of course). Such a population size, according to the authors, is "an exceedingly small population size for this entire 300,000 year period" (16). However, such as small population size was necessary to make the coalescence time as large as it was. Hammer used an even smaller population size (5,000), since he was concerned that his study would not be accepted if the coalescence time was too small (which he admitted to doing in Internet dialogs). The first two studies (Dorit, et al. and Hammer) have very large confidence intervals, due to the small number of nucleotide base pairs analyzed. Given the size of the confidence intervals in the first two studies, the numbers from all three studies are basically the same. Obviously, the Whitfield, et al. gives the most precise estimate of the date for the appearance of modern humans.

Those numbers are that large only because the researchers picked unrealistically small population estimates. At least I think they are unrealistically small. What do you estimate the average total human population was between 30,000 BC and 3000 BC? I think it was in the millions by 3000 BC.

They picked those numbers as a slight of hand measure to conceal the fact that the total diversity was so much less than expected. Let go of the 200K number- unless you also think there were only 7,500 humans until 2000 BC!

I'd like to see the numbers crunched with a more realistic estimate of the total human population. They might show that the bottleneck was shockingly recent. Maybe 28K ago.

39 Posted on 07/08/2001 15:07:00 PDT by Ahban
[ Reply | Private Reply | To 38 | Top | Last ]


To: Doug Fiedor

Doug, I'm glad you seem to know so much about archeology. I have a book here..."The New Evidence that Demands a Verdict by Josh McDowell. He says on p376"Elba's version predates the Babylonian account by some six hundred years."

One the previous page McDowell reports that their was an inscription that refers to the goddess Ishtar "who shines brightly in Elba." I guess that was from after the takeover you referenced.

We seem to have a disagreement of sources. Maybe the civilization of Sumer was older, but do we have a record of the creation account from Sumer older than the one found in Elba?

40 Posted on 07/08/2001 15:23:41 PDT by Ahban
[ Reply | Private Reply | To 32 | Top | Last ]


To: VadeRetro Patrick Henry

Vade, I know it is long, so maybe you missed where they talked about the results of Y-Chromosome studies (NOT mtDNA, and NOT the comparison of Ape-Human gene diversity). It said ....

The other study used a very large piece of the Y chromosome (18,300 base pairs) and calculated a last common ancestor date of modern man of 43,000 years ago (minimum of 37,000 and maximum of 49,000 years ago) (19)

Besides that, those numbers from the table only show the common ancestor back as far as they do by having an UNREASONALBY low estimate of the total population in pre-history. They assumed the total average human population until about 2,000 years ago was only 7,500 persons. One assumed only 5,000 because he needed a low number to get the estimates back to where his evolutionary assumptions thought they should be. Put in a more reasonable number and you get a more recent date. See my post on this, just back a few.

So you have Y-Chromo agreeing with the best (longest sequnceing) mtDNA. The others used creative math to push the date of common origin back.

It seems like you almost caught yourself being reasonable and conceding a point, then got a hold of yourself and hardened up. IF the most common human ancestor really did show up 47K ago, YOU do have a problem linking him to any previously existing forms. What is more, there is a gap in all kinds of biped fossils from 80K to 50K ago, neglecting Neardetals. They all seam to disapeer.

Look, Patrick Henry is only being honest when he says words to the effect of "IF the common ancestor IS this recent, then we have a gap in the fossil record. However, such a gap DOES NOT disprove evolution!" You immediately rush in and chastise, telling him "you ought to know better" than to talk about a fossil gap. HE was not thinking of "leaving the plantation" as near as I can tell.

Your argument does not collapse if you admit that "IF the common ancestor IS this recent, then we have a gap in the fossil record. However, such a gap DOES NOT disprove evolution!" This dogged insistence that "we don't have a problem here" is.....well, I don't care to say.

41 Posted on 07/08/2001 15:48:40 PDT by Ahban
[ Reply | Private Reply | To 34 | Top | Last ]


To: Ahban

Sheesh! My spelling on that last post was horrible. Apologies to all. I'm gonna take the rest of the day off.

42 Posted on 07/08/2001 15:50:46 PDT by Ahban
[ Reply | Private Reply | To 41 | Top | Last ]


To: Ahban

Still, many of those "proofs" are just as much evidence for a common designer as common ancestor.

Everything is "proof" of ID. Even if something seems goofy, that's the way the ol' Designer did it. That's why it's not a scientific theory. Evolution, as we all agree, could be disproven. For ID to get any scientific traction, we need to see actual evidence of alien visitations in the past. Prolifieration of species, because it has a plausable natural explanation, just doesn't do the job. We need to find the alien's ship, or something equally convincing.

43 Posted on 07/08/2001 16:40:37 PDT by PatrickHenry
[ Reply | Private Reply | To 33 | Top | Last ]


To: Ahban

Vade, I know it is long, so maybe you missed where they talked about the results of Y-Chromosome studies (NOT mtDNA, and NOT the comparison of Ape-Human gene diversity).

Perhaps you misunderstand my objections. The human-ape Y-chromosome differences are unaffected by any bottleneck in human descent. The divergence figures to be the same. That would be a good study, but it doesn't help you.

The one you laboriously described is more evidence of a population bottleneck perhaps 50K years ago. That's all it proves. Deem has his cake twice by citing this rather un-biblical bottleneck in his first section, then ignoring as you do the effect on "last common ancestor" studies. When you throw out mtDNA and the stuff that only proves the bottleneck, there's nothing left that helps your case.

They assumed the total average human population until about 2,000 years ago was only 7,500 persons.

They assumed the male population was 7,500 average for about the last 300,000 years. Males carry the Y chromosome. So the average total ancestral population was 15K over that long period.

Looks OK to me as a guess. Much of that span was ice-age conditions, when the habitable zones were contracted. All but the last few thousand were no-tech. We know the population densities for stone-age hunter gatherers are very low even in a fertile setting. We know that the human population was very low even at the start of recorded history. You're getting shut out here.

44 Posted on 07/08/2001 16:45:01 PDT by VadeRetro
[ Reply | Private Reply | To 41 | Top | Last ]


To: VadeRetro

I am having a religious experience. A thread without gore3k. And a discussion that has prospects of going somewhere.

45 Posted on 07/08/2001 16:56:28 PDT by js1138
[ Reply | Private Reply | To 16 | Top | Last ]


To: js1138

I won't flag g3 if you won't. Whew!

46 Posted on 07/08/2001 17:03:16 PDT by VadeRetro
[ Reply | Private Reply | To 45 | Top | Last ]


To: Ahban


Maybe the civilization of Sumer was older, but do we have a record of the creation account from Sumer older than the one found in Elba?


Well, let me see here . . . there are a few scholars at the Vatican in Rome who have studied such things all of their lives who agree with me. So, too, do some Rabbis who live in that neighborhood and can read ancient Hebrew and the cuneiform tablets. More recently, Zecharia Sitchin translated a couple thousand of the old tablets and the ancient Hebrew version of Geneses.

I discounted Sitchin -- but certainly not his ability to read ancient Hebrew and cuneiform -- for many years. Now I come to learn that he has quietly converted a great many religious scholars in a some of the world's major religion. So, it is time for me to reconsider Sitchin.

I am in no way a religious scholar. However, I have been reading about the antics of Enlil, Enki, Ninharsag, Marduk, Ninurta, Inanna, and the rest of the gang, for many years. I even know some of the adventures of Gilgamesh and (the artificial man of great strength) Enkidu when they took their little walk over to the Cedar Mountains. The ancient Ibri (Hebrew) wrote many such stories -- some of which are published in English. So, I can't tell you how many versions I have read about the scientific work of Enki and Ninharsag (Sud) as they created Lulu Amelu -- "The Mixed Worker" later to be perfected into what we now call homo sapiens. That is what is interesting about the very ancient Sumerian tablets.

However, just because I know many of the stories does not mean that I necessarily believe them. Still, many religious leaders are starting to rethink all this ancient history in the light of the writings recently unearthed and interpreted. (There are thousands of tablets that have never yet been read) The problem is, there were plenty of spinmeisters on the earth in those days, too, (Marduk was a prime example) and some of them could write.

Anyway, to subscribe to the new theories percolating up from the scholars in the various religious communities studying this stuff, one would have to say that the prototype of man was created 300,000 years ago and was not quite finished until just before the Deluge -- whenever that was. Pre and post Deluge records are available from Sumer.

Interestingly enough, the Old Testament tracks rather well with all these old tablets. It's just that the Old Testament leaves a lot of information out. The new interpretations and readings may disturb some people. But, at the moment they are one of the top subjects in the scholarly back rooms in various religious communities. It is also rather interesting to me that, many years ago, a few of the ancient Hebrew reading Rabbis knew (and/or guessed) much of what we call "new information" today. I read a book that is well over 100 years old in which a Jewish scholar summarized much of the information that was only proven from recent digs.

Nonetheless, it is not important how old a text is. Just because someone wrote it does not mean that I must believe it. Many of the authors were the major politicians of their day. Which means, we should read their writings in that light.

I certainly do not have any of the answers. But, I have been following these stories off and on for well over forty years.


47 Posted on 07/08/2001 17:19:48 PDT by Doug Fiedor
[ Reply | Private Reply | To 40 | Top | Last ]


To: VadeRetro

They assumed the male population was 7,500 average for about the last 300,000 years.

I donno. That may be right in pre-agricultural times. But starting maybe 5,000 years ago, or thereabouts, the population boomed. At least in the centers of early civilization -- which were probably the same as the areas where agriculture was being practiced. I suppose a tiny population for most of our species' early generations could easily explain the lack of fossil remains.

48 Posted on 07/08/2001 18:37:59 PDT by PatrickHenry
[ Reply | Private Reply | To 44 | Top | Last ]


To: VadeRetro

I am not refering to the ape-human comparison in section two of the post, but in section five, right after the mtDNA stuff. I'll post it...

Y-chromosome analysis

In 1995, scientists have examined human origins from the perspective of male genetics (16, 17). Scientists have examined a gene (ZFY), which being on the Y chromosome, is passed down only from father to son. Thirty-eight men were chosen from all over the world (Africa, Asia, Australia, Europe, and Northern, Central, and South America). Scientists determined the actual genetic sequence in each man for this gene, which is 729 base pairs long. To their surprise, all men had identical genetic sequences (over 27,000 base pairs analyzed). Scientists have calculated the most probable date for the last common ancestor of modern man, given the sequence diversity from modern apes. Using two different models this date is either 270,000 or 27,000 years ago. However, both these models assume that the male population during this entire period of time consisted of only 7,500 individuals. The date estimates from these models would be significantly reduced if the male population were higher than 7,500, which is very likely. Two separate studies using similar techniques looked at larger pieces of the Y chromosome, which would reduce the uncertainty in the calculation of dates. One study examined a gene which was 2,600 base pairs and determined a last common ancestor date of 188,000 year ago (minimum of 51,000 and maximum of 411,000 years ago) (18). The other study used a very large piece of the Y chromosome (18,300 base pairs) and calculated a last common ancestor date of modern man of 43,000 years ago (minimum of 37,000 and maximum of 49,000 years ago) (19). This latter study also examined mitochondrial DNA from women and determined an origination date of 90,000-120,000 years ago.

So here we have a study that uses a large sample of Y-Chromosome (not ntDNA) and compares it to ape DNA. The other Y-Chromo studies quoted were based on similar techniques. Since the time is based on divergence from APE DNA I don't think you can claim it is a bottleneck from a human population that diverged long before. As you said earlier...

Perhaps you misunderstand my objections. The human-ape Y-chromosome differences are unaffected by any bottleneck in human descent. The divergence figures to be the same. That would be a good study, but it doesn't help you.

Why not? What am I missing. You just said "human-ape Y-chromosome differences are unaffected by any bottleneck in human descent". So how can you then claim it is only showing a bottleneck, not origins? How can you then say

The one you laboriously described is more evidence of a population bottleneck perhaps 50K years ago. That's all it proves.

What gives???????

Also, I don't see how you can say a population estimate of 15,000 people on the whole Earth was reasonable until 2,000 years ago. Even at the end of the last Ice Age, 12K ago, we have human settlements all over the globe. I guess we could argue about that back in forth, but maybe Fiedor or one of the others has some hard facts that could help us sort that out....

49 Posted on 07/08/2001 19:06:04 PDT by Ahban
[ Reply | Private Reply | To 44 | Top | Last ]


To: PatrickHenry

For ID to get any scientific traction, we need to see actual evidence of alien visitations in the past. Prolifieration of species, because it has a plausable natural explanation, just doesn't do the job. We need to find the alien's ship, or something equally convincing.

Ok. I am having a mini-brainstorm. Let's say you were visited by aliens. They enter your room at night. They came in and used their technology to fix your bad back or something. They tell you that they have been visiting Earth for 1 billion years. They have in fact seeded it with life forms of their own design throughout the ages. Most of what looks like animal evolution to you is instead their handiwork. Then they leave. Your back is still fixed, but you wonder, did it really happen? Do I accept their claim as "proof", as "probably" or as "perhaps"? Or do I just dismiss it and stick to macro-evolution ?

Play along here. What would be your response?

50 Posted on 07/08/2001 19:14:19 PDT by Ahban
[ Reply | Private Reply | To 43 | Top | Last ]


To: Ahban

OK, it looks like I missed an ape reference: " . . . given the sequence diversity from modern apes." Even with that, three out of the four studies support my 120K date much better than your 40-50K. You and Deem cite these studies while saying, ". . . except they stupidly published the wrong conclusions."

51 Posted on 07/08/2001 19:29:56 PDT by VadeRetro
[ Reply | Private Reply | To 49 | Top | Last ]


To: Ahban

I don't know why you insist on a minimum of 200K for the origin of common human ancestor.

How is that you ask this in reply to the post where I said this?

although I said, the 200K year figure for the last common female ancestor seems to establish a minimum age for modern humanity, on second thought it's not so clear. Sharing mtDNA with that female doesn't necessarily imply much sharing of other parts of the genome.

I picked 200K because that's the estimated age of the last common female ancestor. It seemed to me at first that inheriting that female's mtDNA would imply inheriting a lot else too. As I indicated, upon reflection that doesn't really hold water.

52 Posted on 07/08/2001 20:34:00 PDT by edsheppa
[ Reply | Private Reply | To 39 | Top | Last ]


To: Ahban

Let's say you were visited by aliens. They enter your room at night. They came in and used their technology to fix your bad back or something.

I might personally be convinced, but if I had no evidence, I would end up like the Jodi Foster character in "Contact," with no way to persuade anyone. I might even become a lone whacko, or an unappreciated poster on FR, like medved. This is always the problem with a personal experience which cannot be verified by objective evidence. (We'll assume the cure for the bad back could always be explained away.)

53 Posted on 07/09/2001 04:07:52 PDT by PatrickHenry
[ Reply | Private Reply | To 50 | Top | Last ]


To: Ahban

The Bible has been thoroughly discredited, and not only by Newton and Darwin. For just one example, how can Light have been created before the Heavens and the Earth ? Light emanates from stars !


BUMP

54 Posted on 07/09/2001 04:28:13 PDT by tm22721
[ Reply | Private Reply | To 1 | Top | Last ]


To: PatrickHenry

That is right. That is about like I feel. It WOULD be evidence. Not scientific evidence, but "Historical-Legal" evidence- like in a court of law. You would strain to show people, scientifically, since they had not been visited, that the aliens had a hand in things.

God is the alien in this analogy. About two-hundred million Americans "believe" in God, but a fair number- maybe tens of millions such as myself, have had 'supernatural' experiences with him. Supernatural means God did it, but we just don't know how yet.

My step-brother in law for example, was healed of a crippling leg injury that had plauged him for years. After they prayed for him in the name of Jesus, the brace did not fit anymore. His crippled leg actually straightened out and grew right there on the spot. After an hour or so of trying to walk around in a leg brace that no longer fit, he took it off and has walked fine ever since. THat's one example.

When a God who does stuff like that says in the Bible that He created man, and uses a Hebrew word that means a fiat miracle, I believe it. I get confident that someday the science will catch up with that information, or at least never discredit it. If you could demonstrate macroevolution in the lab or field, it would just about finish off ID.

I guess that is the root source of the conflict. We interpret all evidence based on our personal experience, in many cases supernatural, with the living God. It is only reasonable to us that each new fact uncovered be seen through this lens. For those who have not been "visited", each bit of evidence is interpreted through the lens of naturalism.

That "Contact" analogy is a good one. She could not "prove" a thing to the sceptics, but she had knowledge and experince that they did not have, this risking a "kook" label. I know this does not "prove" ID, I am just trying to examine the root of our clash for better understanding. I don't know if I succeeded or not.

55 Posted on 07/09/2001 06:12:06 PDT by Ahban
[ Reply | Private Reply | To 53 | Top | Last ]


To: tm22721

Thank you for giving me an excuse to repost my Genesis Chapter 1 lesson! I suspect that you may be a Christian who did it deliberately so I could slam it out of the park. If not, I hope this will clear up your "scientific" problems with Genesis One.

I will attempt to post something that a couple of creationists have asked me about. This is my near-verse by verse Bible lesson on Genesis Chapter one. I am indebted to Dr. Hugh Ross (http://www/reasons.org) and Don Stoner "A New Look at an Old Earth", for much of this lesson. This lesson is meant to be read along with a Bible open to Genesis Chapter One.

My explanation of why the text of Genesis one almost demands that we use a day-age interpretation of the chapter is near the end of this lesson, so if you are perplexed on that one, keep reading.

The first thing we need to do for Genesis Chapter One is determine the perspective of the observor. Descriptions that follow will make more sense if we know from what position the observor is describing the scene. For Genesis 1 we see that the position of the observor is not out in space somewhere, but just above the Earth's surface. Verse two says the Spirit of God was "hovering over the surface of the waters"

THe word used for "create" in verse one is the strongest possible Hebrew word for creating. It indicates a fiat miracle. The heavens and the Earth were created from scratch. This is another lesson, but the Big Bang is actually supportive of the text of Genesis one. Not every creation story has a begining for space and time. Many are more akin to what would be a "steady state" view of the universe. The Big Bang affirms Genesis 1:1.

The Earth was "without form and an empty waste". It was dark, and watery. Science teaches that planetary systems form in huge solar nebulas. Stars form with disks of gas and dust around them that condense into planets.

In the very early stages of this process, new stars shine very weakly and even inner planets have super thick atmospheres like the outer planets still do today. We think that the outer planets retain their orignal atmosphere due to their great distance from the Sun, while Earth's early atmosphere was blown away by the solar wind. It also undergoes other changes that have certain effects as we shall see later in the chapter.

The upshot of all of this is that it is dark if you are stuck just above the surface of the very early Earth. The crust is still molten just below the surface, and no continents have had time to form. In such a situation it is natural that water should cover the early Earth. The surface is flat. No pileup of continetal crust has had time to occur. The planet also had a lot of radioactive minerals that have since cooled down, so it was a lot hotter then, despite the Sun's weakness. Lots of steam is coming off of the world-wide ocean.

Verse 3. Basically God says it then it happens. No creative word is used here. That probably indicates that it was unfolding according to God's plan. He did not have to intervene (i.e. "do anything"). What this is describing is the point where the Sun gets strong enough to poke through the nebula and thick atmosphere that surrounded the very early Earth. It would be a "bright nebula" at that point. In other words, a glowing cloud just like the ones we see today. This would either be an all-encompassing nebula or a dusty disk which had the early Earth enveloped within it. Light from the star would be diffused in all directions, and so there would be no night at first. No matter which side of the planet one was on as Earth rotated, one would see a dull glowing light in the sky. He is on a planet in the middle of a glowing cloud or disk. There is no "night" at this point, but as soon as the atmosphere gets thin and cools enough so that the steamy surface disapates somewhat, he can see the light that is diffused in the nebula (or disk).

Verses 4 and 5 speak of the point in Earth's early history when the nebula/disk is pushed away by the solar wind. God may have also done something providential to cause it to separate in "just the right way" to keep Earth on track for habitation later. Once Earth is out of the Nebula/disk, day can be distinguished from night.

Our observations of most stars with planets shows that it is very unusual to have an orderly solar system like ours. Either a nearby huge star blows all the disk away (including the part that could later become a planet) before a planet gets a chance to form, or the dust stays around long enough to drag the local Jupiter into a super-close orbit. It would wipe out any inner planets as it was dragged in.

Verses 6-7 seem to speak of the forming of a stable water cycle. We take it for granted, but it is by no means automatic that a planet will develop one. Before this there was probably a continous mass of steam from the ocean's surface to high in the sky. Now we have a cloud layer of water above and the larger layer of water in the world-wide ocean beneath.

Verses nine and ten speak of the emergence of continents. The radioactive elements that kept early Earth so hot that the crust was always melting and reforming (Earth is "formless and void") have now decayed enough for solid rock to start piling up. The flat, water covered Earth now has a separate water and land part. These verses are another case where God did not have to "do anything". He just spoke it and it was done. Once again this may indicate that things were unfolding according to His plan.

Verse 11 indicates the emergence of plants. Once again, it is a case of where God said it and it was done. He did not have to "do anything" extra. He told the earth to sprout plants and the text says that THE EARTH did it. In that sense, the Bible really has nothing to say against the evolution of plants. It is interesting to note that the three types of plants listed in verse eleven are listed in the order that the fossil record says they appear. "Tender vegetation" is stuff like mosses, liverworts, and the like. Those whose seed is in themselves (but without fruit) sounds like conifers (pine trees). Flowering plants come last in both the fossil record and Genesis 1:11.

It is no coincidence that verses 14-18 come after plants in verses 11-12. The setting of the Sun, Moon, and stars in the sky comes after the introduction of plants has substantially altered Earth's atmosphere.

The word for "made" in verse 16 is a very broad and general word. It can mean "caused (made) to appear". In this verse it apparently does mean that. Hebrew does not have verb tenses per se, but it does have a way of designating already completed actions. I am not an expert in Hebrew, but I am told that here it speaks of somthing that is an already completed action. I. E., the Sun, moon and stars were created in 1:1, but were not distinct or visible from the surface until the changes in the atmosphere prompted by the introduction of plants occured.

CO2 was changed into O2 in massive quantities when plants came on the scene. At first, there were no animals to turn it back into 02. This meant that global temperatures plummeted (from their previous steamy levels) as the greenhouse gas CO2 was removed from the atmospere. This meant much less evaporation, and this meant much less cloud cover. As the world-wide cloud layer disapated, Earth had its first sunny days and clear nights.

The "waters that were above" referenced in verses six and seven became much less significant than the oceans at this point. So much so that later skeptics would say "how could those Hebrews think there was an ocean of water in the sky?". Truth is that there was, but it has lessened since that time.

Verses 20-22 are at least partly talking about what we know as the Cambrian Explosion, but I think it goes well beyond that to other creative events. The waters suddenly swarm with living creatures, and creatures that multiply in the water by swarms (certain insects?)

The word used here is translated "created", not the more vague "made". It is the same word used in 1:1 and indicates a fiat miracle. I have looked at it from every angle and I don't see how it permits pure naturalistic evolution to be fully or even mostly responsible.

That word is very strong. I have no objection to the idea that God built in a certain amount of adaptablilty into His creatures, and that evolution plays a role in their diversification, but I don't see a reasonable way around Divine (or at least intelligent) intervention either scripturally or scientifically.

The "winged creatures" or "fowls of the air" part is not so clear cut. Those words are sometimes translated as winged insects. If that is true it could be speaking about a very short period of direct creative acts and a lot of evolution since then. If it means birds as well, then we are talking about God the Son dropping newly created critters into the biosphere from the Cambrian to the Mesozoic at the least.

I don't know why this should be so hard to accept. We have scientists right now conducting genetic experiments that create creatures that evolutionary mechanisms alone would never create. Monkeys with the glow gene of a jellyfish in their skin for example. So God did what we are now doing, but on a massive scale.

Who would have guessed that birds came in the fossil record before Cows and dogs? They did though, as early as the dinos themselves for all practical purposes, and certainly before any land animal that the Hebrews would be aware of. It makes sense to put birds before the land animals spoken of in the next verses.

Verses 24-25 refer to the creation of land animals. The weaker word "made" is used. It does not mean that there was no direct divine intervention, I think there was. But the word is less strong than that used in 1:1 and the prior verses. I believe the word as used in this verse allows (barely) for God-designed natural systems to providentially work it out (evolution) even though I am not scientifically convinced that this is what happened. My guess is that the word is used because evolution did most of the gruntwork, while God dropped in some new life forms from time to time.

Verses 26-27 are where man is created. Guess what. Verse 27 uses the stronger word translated "created" rather than the more indirect "made". It seems that God (the Son) had a very direct and personal hand in the creation of the Human Race.

I do want to point out that if you read on in to chapter two, you realize that the text does not speak of the seventh day ending. There is no "and the evening and the morning were day seven". The implication is that the seventh day, where God has rested from His creative works, is still ongoing. This allows for a testable creation model. That is another topic though.

My main point here is that the Hebrew word "Yom" used for DAY is a very vague and broad word, much like our english word day. We can use the word for an age as in "the day of the dinosaurs". So did the Hebrews.

The phrase "morning to evening" means a 24 hour literal day, but the phrase "evening and the morning" often DOES NOT refer to a literal 24 hour day. In the book of DANIEL, he is told to seal up the book of the vision "of the evening and the morning". Many translations make this a plural, because it is clear that the vision refers to a period of several years at the end of the age, but it is singular in the original text.

The issue of why God "had to do it this way" instead of desiging a world that would use all evolution and just unfold is a separate lesson. If God is all knowing, why did He have to make the universe, then jump in later and make animals and man?

Why did He not make a universe where it would all unfold without further direct intervention? After all, 98% of it seems to unfold without His direct intervention. A lot of it has to do with Freewill vs. Predestination and the question of how a loving God could create people that He knew would reject His love and be exiled to Hell. That one is going to have to wait for another night.

Ahban

56 Posted on 07/09/2001 06:18:58 PDT by Ahban
[ Reply | Private Reply | To 54 | Top | Last ]


To: Ahban

I don't know if I succeeded or not.

Sure you did. The Jodi Foster example is a good one for a specific reason -- Carl Sagan knew what he was doing when he wrote the book -- it was filled with clashes between science and relgion. No one knows, really, but it may very well be that nowadays god does his miracles on the sly, only making appearances in such a way as to leave no objectively verifiable clues, and always leaving us with some plausable reason to be skeptical. Hard to know the purpose for this, other than what the believers say: "He's testing our faith." But that would mean that our most rational people would be certain to end up in hell. I have doubts that the god I conceive of would operate like that. But no one knows.

57 Posted on 07/09/2001 07:02:45 PDT by PatrickHenry
[ Reply | Private Reply | To 55 | Top | Last ]


To: Ahban

Here's my interpretation of Genesis. It is an ignorant account of cosmology in which we discover that there is a solid roof suspended over a flat earth on pillars, with sun, stars, and moon suspended within --the latter giving light, not reflecting it. There is water above this roof, with "windows" set in it allowing God (who lives above it) to let the water fall as rain. Nimrod tried to take heaven by force by building a tower high enough to get his chariots above this roof. The whole depiction is that of a domed temple. It was ripped off word-for-word from the Babylonian creation myth which the Jews adopted during their captivity there.

58 Posted on 07/09/2001 07:27:04 PDT by Hillary makes me Hot
[ Reply | Private Reply | To 56 | Top | Last ]


To: PatrickHenry

But that would mean that our most rational people would be certain to end up in hell.

Could you look at post #58 just above this post for me? Is that an example of a "rational" person? Technically it is. He jumps to all of the post-modernist conclusions. Anytime the meaning of something is in doubt, he interprets it in the worst possible light and concludes that it must all be just a silly myth. He appears to make no effort to discover if there might be truth in the Word. He is too "rational" for that.

There is nothing more rational than the conclusion that our four pounds of grey matter are not big enough to know life's larger truth's without Help. That is a very rational conclusion when comparing the vastness of creation with our abilities to understand it. The decision to interpret data through the filter of belief rather than skeptism is a hopeful one, but not an irrational one.

The same Bible that contains the creation account contains the passage "Now we know that knowledge puffs up, but love edifies." Would you rather be in a world full of sneering, mocking, HilaryMakesMeHot posters who worship their own ability to reason, or sincere believers and practicers of the Bible (about 15-20 percent of church goers I'm afraid)?

Micheal W. Kelly says it better than I can. Here is an excerpt of an excerpt on another post from his book...

"The cultural urge, the will to rule and to have power is increated."* We might say that man has the natural-born "impulse" to power. It is basic to his nature as man to seek to exploit this God-given power for the sake of producing culture and civilization. However, it must not be forgotten that man has fallen into the darkness of sin. A religious and moral perversion of his nature has now come to have control of all that he is and does, including the "cultural urge." Man does not thereby lose the driving impulse of his nature, but it becomes an instrument of his rebellion against God. He still seeks the fulfillment of the cultural agenda, but now no longer on God's terms, or on God's behalf. Instead of developing his power, which is to say his talents and abilities, from a love for God and his purpose, he seeks rather to form his nature and his world solely from the motive of self-love.

This religious change of direction will have undoubted consequences for his perspective on culture. He will interpret the discoveries of the natural world, along with his place in it, entirely in terms that suit himself. Rather than clinging to God's interpretation of his life and activity as revealed in God's word, man prefers to follow the promptings of his rebellious nature. He may think that he is merely following the dictates of reason, but he is simply using his powers of reasoning to conjure a world of meaning from self-justifying motives -- motives based upon a changed religious directive.

59 Posted on 07/09/2001 09:20:24 PDT by Ahban
[ Reply | Private Reply | To 57 | Top | Last ]


To: Ahban

Could you look at post #58 just above this post for me? Is that an example of a "rational" person? Technically it is. He jumps to all of the post-modernist conclusions.

Merely spouting a set of conclusions doesn't make one rational. Often it's an attempt to simulate rationality -- or what the speaker thinks might be rationality. I've dated too many idiot girls who tried to appear stylish in their "ideas" by repeating stuff that they had seen some celebrity say. Anyway, I'm not responsible for anyone's views but my own; just as you don't want to be tarred with the brush of some genuine whackos who quote scripture.

60 Posted on 07/09/2001 10:49:19 PDT by PatrickHenry
[ Reply | Private Reply | To 59 | Top | Last ]


To: VadeRetro PatrickHenry edsheppa

Vade, re your #51.

How in the world can you argue that three of the four studies support your conclusion better than mine? Look at that table below the footnotes again.

The Dorit study only analyzed 729 base pairs. That is why they have a wide margin. Still, one method of analyzing the data gave a mean of 270K ago and an upper limit of 800K. That DOES support your conclusion. This conclunsion only holds true if the average male population until the last couple of thousand years ago was 7,500 or so. More on that later.

It is my understanding from another source that Dorit actually anaylzed this data with the star phylogeny method first. That is the second entry on the table. It has an upper limit of 80K and a mean of only 27K years ago. That supports MY conclusion. Once again, it is based on the same tiny population size. If the population size was much larger than this, then those numbers come my way big time.

The Hammer study used more base pairs, which should have increased accuracy. I think it did. Remember the other study examined 729 base pairs in 38 diverse men and found ZERO differences. He got numbers that were too young for him to feel comfortable with. That is why, in a stunning display of the choke hold evolution has on modern scientific research, Hammer lowered the population estimate far below the absurdly low level used in the previous study. He did this, IMHO, in order to get a number evolutionists would feel comfortable with. That is the idealogy driving the results when science should do it the other way around.

With the home cooking skewing the calculations, he got a mean of 188K and an upper limit of 411K. That goes in your column again- IF there was a total world average population of only 5,000 males during pre-history.

The last study used far more base pairs and should have been the most accurate. It had a mean of 43K and a max of 49K. That one has to go in my column, even if the Vela Super Nove did not raise mutation rates for a few Ks and make the numbers look higher than they are for recent species.

So two for you, and two for me- If those population estimates are reasonable. They are not. Below is an excerpt from a web site that quotes a study and has a graph on this issue. It shows the "human" population crashing to around 10K people (5,000 males) around 65K ago. Something bad happened then. There is a fossil gap around that time. By 50K ago the estimates of the human population get close to one million. They only grow slowly after that until agriculture is developed maybe 10K ago. Then there is another boom.

I have seen population estimates for some of the world's earliest cities. I'm talking about 5,000 years ago, 7,000 years ago. The archeologists on the scene rate the population of those single cities as being double, triple, and even quadruple Hammer's claim of the population of the whole Earth at that time! There is simply NO way the population was ever that low, except right after whatever wiped everything out 70K ago (or maybe after The Deluge!). When humans appear 20-30K later they sweep over the whole Earth, multiplying wildly.

You can go from a breeding pair to over one million individuals in 30 generations if each couple has four surviving kids. With 40 years per generation, that is only 1200 years. Here is the excerpt...

It has been argued that a population crash occurred about 65,000 years ago (-4.8, Fig. 1), presumably due to the prolonged ice-ages during the preceding 120,000 years (Gibbons, 1993). Humans came close to perishing and Neanderthal became extinct. However, by 50,000 years ago (-4.6, Fig. 1), humans had generated population mini-explosions all around the planet. Deevey's data for population size since 500 years ago have been replaced with more recent estimates taken from The World Almanac, (1992 - 1995) including population projections out to 2025.

Those 7,500 male population estimates are too low! For the 120K ago number to be right not only does mtDNA have to be wrong, and wrong in your direction, but Y-Chromo DNA would have to be wrong in your favor as well! (recent evidence indicates that mtDNA might be wrong IN MY DIRECTION- paternal mtDNA can somehow get in during mitosis. This would make more changes and make mtDNA seem older than it was).

61 Posted on 07/09/2001 14:08:39 PDT by Ahban
[ Reply | Private Reply | To 51 | Top | Last ]


To: Ahban

I was reading the paragraph under "Y-Chromosome Analysis." You were reading from the table farther down. When I reread that paragraph, I still get the same answer I did before. This is poorly written.

Still, one method of analyzing the data gave a mean of 270K ago and an upper limit of 800K. That DOES support your conclusion. . .

It [Same study data, different analysis] has an upper limit of 80K and a mean of only 27K years ago. That supports MY conclusion.

The range of answers you can get by looking at the data in different ways tells me not to be too impressed with the techniques just right now. I realize you have a shortage of evidence for the science of "Evolution Ain't It" and feel terrible about begrudging you anything. Let's just say what's always safe to say, that "Godditit" cannot be excluded here.

62 Posted on 07/09/2001 15:39:13 PDT by VadeRetro
[ Reply | Private Reply | To 61 | Top | Last ]


To: Ahban

Look, are you arguing that the fixation of one particular chromosome over some period of tens or hundreds of thousands of years disproves the idea that modern man descended from non-human ancestors? This argument is clearly flawed.

There is merit to the idea that we can deduce information (in a statistical sense) about ancient human population size from chromosome fixation.

63 Posted on 07/09/2001 17:35:03 PDT by edsheppa
[ Reply | Private Reply | To 61 | Top | Last ]


To: edsheppa

bump

64 Posted on 07/09/2001 21:49:00 PDT by buckster
[ Reply | Private Reply | To 63 | Top | Last ]


To: VadeRetro

The desperation of the evolutionists! If science does not give the answer they want, throw it away:

"Using a more comprehensive method to analyze the genetic material of 15 types of mammals, Duke researchers have shown that the mitochondrial DNA method that links disparate animals (hippo and whale, kangaroo and platypus) is statistically unreliable when it comes to evolutionary genetics"

The absurdity of supposed scientists saying that genes do not prove genetic descent is beyond belief! Just because they did not get the results they wanted, they throw science away. I do not call the above proof of evolution Vade, I call it the desperation of evolutionists.

BTW No wonder you do not post those articles where everyone can see them, they would laugh you off these threads!

65 Posted on 07/10/2001 17:58:10 PDT by gore3000
[ Reply | Private Reply | To 16 | Top | Last ]


To: PatrickHenry

"Do we fall back on what our parents told us and believe that the stork brought us?

Do you think that Darwin brought us?

When you speak of hundreds of millions of years ago, you can use the fossil record as an excuse. However, when we have found tons of examples of Neanderthal and none of our supposed evolutionary ancestors, one has to wonder, when will the evolutionists stop with the silly excuses?

BTW - when it fits them, the evolutionists use the fossil record as proof of evolution, when it does not, they cry about the gaps in it. Heads I win, tails you lose as always with the evos.

66 Posted on 07/10/2001 18:03:48 PDT by gore3000
[ Reply | Private Reply | To 18 | Top | Last ]


To: gore3000

You're too young to know what "statistically unreliable" means. I won't try to explain it just now.

67 Posted on 07/10/2001 18:04:00 PDT by VadeRetro
[ Reply | Private Reply | To 65 | Top | Last ]


To: edsheppa

Utter garbage, mutation takes place in individuals, not in species. It takes place according to generations, not years. If mutation/evolution were true, flies which live only a few days and have always been more populous than man should have a fantastic rate of change while the higher animals should have a much lower one, yet this is not the case. The truth of the matter is, and the only explanation for it is that those species have really not mutated since they arose, that the genetic differences were there from the beginning. So much for evolution of man from rats.

68 Posted on 07/10/2001 18:09:22 PDT by gore3000
[ Reply | Private Reply | To 63 | Top | Last ]


To: Ahban

These people are so interested in "origins," but refuse to study the true origins of Darwin's theory. In reality, Darwin formulated his evolution theory, actually he just copied his GRANDFATHER's (Erasmus Darwin) theories for one reason alone: Darwin could not reconcile the concept of a just and loving God with what he perceived to be "natural evil." Examples of "natural evil" would be a child contracting fatal leukemia, a lion running down a wildebeast and ripping it up, etc. There was a growing movement in Christianity, that came to a peak in the Victorian Era, to separate God from the natural order in order to separate Him from this "natural evil." "God has nothing to do with nature. He is too perfect to be involved in such an imperfect creation." This argument about what "God would not do," is used all the time by the evolutionists, and was used by Darwin as well.

In the book DARWIN'S GOD, there is a passage about a painting of Jesus in the carpenter shop. He has injured his hand, and Mary is cleaning and dressing the wound. Charles Dickens found it offensive to portray Jesus in that kind of scene, in a dirty carpenter shop, with hands dirty so they had to be cleaned in order to treat an injury. This is the kind of reasoning that drove the movement to separate God from nature, and as his grandfather made these arguments, so did Charles Darwin. When Darwin set sail on the HMS BEAGLE, he took with him his favorite book, PARADISE LOST, by Milton. As Milton sought to separate God from moral evil, so Darwin would separate God from "natural evil."

It is amusing watching atheists grasp onto a theory as the "gospel" scientific truth that was always intended as a metaphysical statement about God, and his relationship (or lack of one) with nature, a theory designed to make a THEOLOGICAL point to a bunch of Victorians. A THEOLOGICAL argument, masked as science, is the touchstone of militant atheists! And they say HE has no sense of humor!

69 Posted on 07/10/2001 18:23:32 PDT by roughrider
[ Reply | Private Reply | To 23 | Top | Last ]


To: VadeRetro

You don't know my age and your statement is utter nonsense. Disprove my statements if you can instead of making snide remarks.

70 Posted on 07/10/2001 18:59:02 PDT by gore3000
[ Reply | Private Reply | To 67 | Top | Last ]


To: Russell Scott

Wonder if you'll feel stupid when God says,

"What, evolution, it was my favorite part of creation. Do you know how difficult it was to set up the Big Bang so that humans would evolve? Sheesh, give them eyes to see, brains to think and some of them are still as dumb as a democrat."


71 Posted on 02/27/2002 18:40:10 PST by xcon
[ Reply | Private Reply | To 4 | Top | Last ]


To: VadeRetro; gore3000

Who conjured it up.<P. gore3000, sure you ain't ready to claim you created man as your brother created the internet?

72 Posted on 02/27/2002 18:58:32 PST by xcon
[ Reply | Private Reply | To 67 | Top | Last ]


To: Doug Fiedor

Man did not develop equally throughout the world.

That is true, but you are speaking culturally, not biologically which is what the article is about. Culture, and particularly cultural interaction with other societies is very important in the development of civilizations. However, it has little or nothing to do with biological development.

The differences amongst humans may seem quite large from close up, however, as compared to the differences between humans as a whole and other species, they are quite small. Hair color, skin color, and other obvious differences mean quite little in the scheme of things.


73 Posted on 02/27/2002 20:55:31 PST by gore3000
[ Reply | Private Reply | To 11 | Top | Last ]


To: PatrickHenry

"I don't think anyone disputes the appearance of our species around 50,000 years ago. It could be earlier, but that would require a finding of earlier fossils. And it also seems to be true that we're not descended from the neanderthal. Fine. Now what? Do we fall back on what our parents told us and believe that the stork brought us? "

No, the only reasonable explanation is the one you do not wish to accept - God did it.

Since no ancestors have been found for man, there can be no other explanation - given the evidence before us. Clearly, species which were extinct long before man came along could not have been our ancestors - because the dead produce no progeny.

The typical evolutionist explanation 'we have not found the bones yet' does not wash either. With all the remains of Neanderthals and Homo Sapiens that have been found, it is extremely unlikely that if there had been another species around at the same time, that we would not have found it.


74 Posted on 02/27/2002 21:10:40 PST by gore3000
[ Reply | Private Reply | To 18 | Top | Last ]


To: VadeRetro

We know that the human population was very low even at the start of recorded history.

Total balderdash. The pyramids are over 4,000 years old. The population of Egypt by itself had to be over a million people then to achieve their construction. Sumerian/Babylonian civilization at the time had to be at least as large since they and Egypt were in constant struggles with each other and the Egyptians were never able to conquer them, which they would have if the population of Babylonia/Sumer had been considerably less. In fact, the Egyptians even had a hard time conquering the Sudan which shows it too had a considerable population. So no, your assumptions are nonsense.


75 Posted on 02/27/2002 21:33:06 PST by gore3000
[ Reply | Private Reply | To 44 | Top | Last ]


To: VadeRetro

Bones tell little about a species, and most of the bones which evolutionists use in their tales, are far from complete skeletons. To throw out the results of DNA analysis because they are not in accord with what your bones tell you is totally absurd but then to evolutionists facts are something to be overcome, not something to be followed.

76 Posted on 02/27/2002 21:41:45 PST by gore3000
[ Reply | Private Reply | To 67 | Top | Last ]


To: xcon

Thanks for reviving this old thread. I love reading my long-ago postings.

77 Posted on 02/28/2002 03:40:35 PST by PatrickHenry
[ Reply | Private Reply | To 71 | Top | Last ]


To: gore3000

The pyramids are over 4,000 years old. The population of Egypt by itself had to be over a million people then to achieve their construction. Sumerian/Babylonian civilization at the time had to be at least as large since they and Egypt were in constant struggles with each other and the Egyptians were never able to conquer them, which they would have if the population of Babylonia/Sumer had been considerably less. In fact, the Egyptians even had a hard time conquering the Sudan which shows it too had a considerable population. So no, your assumptions are nonsense.

The figure of a million sounds high for Old Kingdom Egypt. (I don't know offhand what the population would have been but that sounds high.)

Note that your own chain of reasoning collapses if you can build the pyramids with fewer people. Read some non-kook books on the subject. A million people would have been hard to feed there and then, with the technology available, and the housing/infrastructure for that many would have left its traces.


78 Posted on 02/28/2002 06:20:37 PST by VadeRetro
[ Reply | Private Reply | To 75 | Top | Last ]


To: gore3000

To throw out the results of DNA analysis because they are not in accord with what your bones tell you is totally absurd but then to evolutionists facts are something to be overcome, not something to be followed.

The criticism of the mtDNA technique was that it gives answers at variance with other labs running the same test with another bit from the same sample. In other words, it's unreliable. That its results sometimes agree or disagree with those from other lines of evidence is not the point. When you're all over the place, you agree sometimes and you disagree sometimes.


79 Posted on 02/28/2002 06:25:10 PST by VadeRetro
[ Reply | Private Reply | To 76 | Top | Last ]


To: PatrickHenry

"For ID to get any scientific traction, we need to see actual evidence of alien visitations in the past. Prolifieration of species, because it has a plausable natural explanation, just doesn't do the job. We need to find the alien's ship, or something equally convincing."

First, I must comment on my total shock at the civility of this thread........including yours.

As to your point........

Your statements above belie a core belief.......or disbelief.........system that you hold dear. You do not lend credence to intelligent design for you equate that to some form of "alien visitation", that the "intelligence" that did the "designing" would have to be some form of advanced alien life form that happened to pass this way.

Therefore, you completely and totally rule out the Biblical explanation of God as Creator. It just doesn't exist as a possibility in your agnostic-cum-atheist world. That's certainly your right, but that means that you have to be honest enough to admit it and lay that basis for certain prejudice on the table.

It also means that you automatically, by reason of your "faith", eliminate from your thought and reasoning processes an entire set of explanations that have been debated on these threads for years and by men of faith and science for many, many decades.

In other words, ID cannot possibly be the "answer" in your mind because A) you do not believe in God or anything resembling a Creator, and B) you also do not believe that aliens dropped by the 'hood and planted DNA or even whole, living, sentient creatures on the Earth.

All of the above is certainly your right, but it also explains fully why you are not seriously exploring the "Truth"; you're seeking ways to support the theories with which you feel more comfortably fit your mindset. Don't take that as a personal swipe; it isn't. It just makes you like most others with whom I've had similar discussions over the years.

The main difference between you and me is that I willingly admit my biases (I happen to believe God's Word, as much my right as yours is to believe your evolutionary theories).


80 Posted on 02/28/2002 17:57:08 PST by RightOnline
[ Reply | Private Reply | To 43 | Top | Last ]


To: RightOnline

In other words, ID cannot possibly be the "answer" in your mind because A) you do not believe in God or anything resembling a Creator, and B) you also do not believe that aliens dropped by the 'hood and planted DNA or even whole, living, sentient creatures on the Earth.

You've got it exactly backwards. I don't say -- as you claim I say -- that ID (or divine creation) can't the answer merely because I don't believe it. I don't begin with disbelief. To the contrary, I say that I don't believe it because there's no evidence for such an "explanation." Were there evidence, you'd be amazed at how quickly the rational community would turn around.


81 Posted on 02/28/2002 18:46:45 PST by PatrickHenry
[ Reply | Private Reply | To 80 | Top | Last ]


To: PatrickHenry

This is an enjoyable thread. I identify myself as one of those old earth creations who don't have much trouble with the universe being 14 billion years old or the earth being 5 billion years. In this thread I don't find either argument compelling, but then again you aren't in some silly name-calling flame war. Haven't quite made it through every entry here. Anyone mention Fred Heeren? He strikes me as being a pretty reasonable dude.

82 Posted on 02/28/2002 19:30:22 PST by JusPasenThru
[ Reply | Private Reply | To 77 | Top | Last ]


To: Ahban

bump

83 Posted on 02/28/2002 19:40:05 PST by GOPJ
[ Reply | Private Reply | To 1 | Top | Last ]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

[ Top | Latest Posts | Latest Articles | Self Search | Add Bookmark | Post | Abuse | Help! ]

FreeRepublic , LLC, PO BOX 9771, FRESNO, CA 93794
Forum Version 2.0a Copyright © 1999 Free Republic, LLC