Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

In Huge Shock, Mitochondrial DNA Can Be Inherited From Fathers
iflscience.com ^

Posted on 11/26/2018 5:06:59 PM PST by BenLurkin

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-49 last
To: BenLurkin

Does this mean global warming could be fake too?


41 posted on 11/26/2018 8:57:54 PM PST by jerod (Nazi's were essentially Socialist in Hugo Boss uniforms... Get over it!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv; Kolokotronis

Cincinnati Children’s is rated the #1 Childhood Cancer hospital. That transfers year to year between them and Philadelphia Children’s. This year’s #1 came as a result of their research department’s strength and funding. My guess is that this research stems from that center and relates in some way to cancer. My grandson just finished biannual scans there yesterday to ensure his cancer has not returned. He is 3 years clear now. We’re blessed to have him seen there.


42 posted on 11/26/2018 11:01:29 PM PST by xzins (Retired US Army chaplain. Support our troops by praying for their victory.)
[ Post Reply | Private Reply | To 25 | View Replies]

To: Thommas; HangnJudge; SunkenCiv

The tail of the sperm contains mtDNA and if it enter the egg then there might be paternal mtDNA as well.


43 posted on 11/27/2018 1:52:00 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 33 | View Replies]

To: BenLurkin
Explain to me the politics of mitochondrial DNA.

Its just science deniers really. Some old white folks just refuse to classify DNA taken from people like Bruce Jenner and Bradley Manning as "female DNA". This messes up record keeping in scientific record keeping. In the old age, back in the caveman era, we would have classified their DNA as "male DNA" simply because these folks had male genitalia and stuff. But, now thanks to science, we can instead classify their DNA as female... this changes how we view genetics.

44 posted on 11/27/2018 2:13:00 AM PST by Cementjungle
[ Post Reply | Private Reply | To 3 | View Replies]

To: stylin19a
what in the name of randolph scott is that ?

A woman... with a mastectomy... who takes male hormone meds (paid for by taxpayers no doubt) to grow male hair. She got knocked up, and is pregnant.

She probably got knocked up by some guy who dresses up as a woman and takes meds (paid for by us) to make him more "feminine".

Poor kid.

45 posted on 11/27/2018 2:19:33 AM PST by Cementjungle
[ Post Reply | Private Reply | To 30 | View Replies]

To: Thommas; All

Could it be drug-induced mutation of genetic material that is passing more MtDNA to male children and less to the females? ....Could that explain the whole transgender trend over the past decade or so?


46 posted on 11/27/2018 3:44:06 AM PST by octex
[ Post Reply | Private Reply | To 33 | View Replies]

To: Cementjungle

thanks for that...I think.

Poor kid is right.


47 posted on 11/27/2018 10:06:37 AM PST by stylin19a (Best.Election.Of.All.Times.Ever.In.The.History.Of.Ever)
[ Post Reply | Private Reply | To 45 | View Replies]

To: HangnJudge

Human sperm cells need mitochondria to energize their locomotion and then fertilization of an egg. These mitochondria are sometimes incorporated into the fertilized egg and then replicate in embryonic cells. The new discovery consists of proof that an inheritance of paternal mitochondria may result in a clinically proven disease, with additional proof that paternal mitochondria were fairly common in the cells of the studied family. Further research may establish that such inheritance of paternal mitochondria is widespread and of significance in human disease.


48 posted on 11/27/2018 1:02:27 PM PST by Rockingham
[ Post Reply | Private Reply | To 5 | View Replies]

To: RegulatorCountry

Take a look at “fragile X syndrome” for an unhappy view of the effects of inheriting a damaged version of the X chromosome. Call it a feminist disease if you like. With only one X chromosome, affected boys get the worst of it.


49 posted on 11/27/2018 1:10:31 PM PST by Rockingham
[ Post Reply | Private Reply | To 4 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-49 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson