Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: killermosquito; TheOldLady
For macro evolution to have occurred on the scale claimed by the darwinists requires more faith than reason.

One way of looking at it, the total sum of miracles in the Bible is probably somewhere between 30 and 100, and probably more like 30 or 40. By contrast, evolution requires an essentially infinite sequence of probabilistic miracles for every kind of creature which ever existed on the Earth i.e. a double infinity of miracles and zero-probability events.

Which is the religion? What I sometimes tell people is that you could make up a new religion by taking the single stupidest idea or doctrine from each of the existing religions and even THAT would be better than evolution.

Evolutionites within my experience are basically immune to logic but they are not immune to laughter and ridicule. What I ultimately hope to do is to teach people how to laugh at this stuff. Laughter is the one thing which no ideology can tolerate and the one thing which can ultimately get false religions like I-slam and the theory of evolution out of this world.

30 posted on 02/11/2011 9:58:49 AM PST by wendy1946
[ Post Reply | Private Reply | To 27 | View Replies ]


To: wendy1946

For Plato and Aristotle laughter is an emotion involving scorn for people thought of as inferior. Plato also objects that laughter involves a loss of self-control that can lead to violence. And so in the ideal state described in his Republic and Laws, Plato puts tight restrictions on the performance of comedy.

This negative assessment of laughter, humor, and comedy influenced early Christian thinkers, who derived from the Bible a similar understanding of laughter as hostile. The classic statement of the Superiority Theory is that of Thomas Hobbes, who describes laughter as an expression of »sudden glory«.

http://webcache.googleusercontent.com/search?q=cache:ZPVj-aV4LRoJ:www.jltonline.de/index.php/articles/article/viewArticle/238/713+laughter+plato+bible&cd=11&hl=en&ct=clnk&source=www.google.com

So, we have to be careful. ;-)

Have a nice weekend


31 posted on 02/11/2011 10:55:44 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 30 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson