Free Republic
Browse · Search
General/Chat
Topics · Post Article


1 posted on 09/05/2011 12:34:08 PM PDT by Ernest_at_the_Beach
[ Post Reply | Private Reply | View Replies ]


To: TigerLikesRooster; landsbaum; Signalman; NormsRevenge; steelyourfaith; Lancey Howard; ...
75 Responses to “How to go out with a bang — score points for censorship — a poseur for honor!”
2 posted on 09/05/2011 12:35:51 PM PDT by Ernest_at_the_Beach ( Support Geert Wilders)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Ernest_at_the_Beach

WHy shouldn’t they ignore their opponents?


3 posted on 09/05/2011 12:44:46 PM PDT by GeronL (The Right to Life came before the Right to Happiness)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Ernest_at_the_Beach
"How to go out with a bang — score points for censorship — a poseur for honor! "

the world is Heresy

10 posted on 09/05/2011 1:17:34 PM PDT by Steve Van Doorn (*in my best Eric Cartman voice* 'I love you, guys')
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Ernest_at_the_Beach
oops:
the word is Heresy
11 posted on 09/05/2011 1:18:33 PM PDT by Steve Van Doorn (*in my best Eric Cartman voice* 'I love you, guys')
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Ernest_at_the_Beach

Yeah, but check out some comments on WUWT and see where the editor’s “day job” was. “Hockey Stick” Mann and “Perpetually Offended” Trenberth both hold sway over the boards or companies where he’s gainfully employed.

Not surprising at all that he caved, apologized to Trenberth and resigned. Apparently, the board of the publication wouldn’t back him in rescinding the Spencer paper after Trenberth et al gave him his marching orders.

What an incestuous, grade-school mentality these AGW proponents share. “Scientist” is one term that cannot be applied to them.


14 posted on 09/05/2011 1:49:04 PM PDT by hadit2here ("Most men would rather die than think. Many do." - Bertrand Russell)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Ernest_at_the_Beach
I got my copy, not taking any chance that it would "disappear."
15 posted on 09/05/2011 2:25:24 PM PDT by JoeFromSidney (New book: RESISTANCE TO TYRANNY. A primer on armed revolt. Available form Amazon.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Ernest_at_the_Beach; SunkenCiv

Comments by Lubos Motl:

The consensus scientists and Greenpeace members who believe that the judgement day is approaching were not pleased by the publication of a paper by Spencer and Braswell. In fact, they forced the editor of the journal to resign.

Finally, they found the answer: they decided to publish their own paper, one that rejects the basic assumptions of Spencer and Braswell. And they agreed that the paper should be published much more quickly than any other paper – they should circumvent the usual multi-month delays – because it was totally urgent and critical for the survival of life on Earth to show that Spencer’s and Braswell’s paper was totally unimportant.

http://motls.blogspot.com/2011/09/andrew-dessler-clouds-dont-reflect.html


21 posted on 09/06/2011 3:40:44 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Ernest_at_the_Beach
Normally, if people think something is wrong with a paper they just write a reply…

Well, yeah. But the reply is ad hominem rather than to the facts.

23 posted on 09/06/2011 3:55:19 PM PDT by AndrewC
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson