Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

To: thecodont; gleeaikin

More background info with references here

http://www.nature.com/scitable/blog/viruses101/hiv_resistant_mutation


51 posted on 05/13/2014 12:09:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 50 | View Replies ]


To: AdmSmith; thecodont; blam; All

Thanks for this link giving further information about the existance of the gene which seems to give some protection against AIDs, and may have survived due to also conferring resistance to the Black Death and/or Smallpox.


63 posted on 05/13/2014 9:17:19 PM PDT by gleeaikin
[ Post Reply | Private Reply | To 51 | View Replies ]

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson