Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Cancer Cells Can't Proliferate and Invade at the Same Time
Scientific American ^ | 1/1/16 | Viviane Callier

Posted on 01/04/2016 12:40:51 AM PST by LibWhacker

click here to read article


Navigation: use the links below to view more comments.
first 1-2021-4041-53 next last

1 posted on 01/04/2016 12:40:51 AM PST by LibWhacker
[ Post Reply | Private Reply | View Replies]

To: LibWhacker

It’s my humble guess....that within ten years...we will have some ability to find cancer within your body (stage one episode) and somehow turn it off from spreading. You might still die from cancer, but it’ll be twenty-five years later.


2 posted on 01/04/2016 12:48:09 AM PST by pepsionice
[ Post Reply | Private Reply | To 1 | View Replies]

To: pepsionice

Oh, I hope so. It’d be fantastic to give everyone a 25-year reprieve.


3 posted on 01/04/2016 1:09:17 AM PST by LibWhacker
[ Post Reply | Private Reply | To 2 | View Replies]

To: LibWhacker

The cure for cancer is just around the corner . . .


4 posted on 01/04/2016 1:20:17 AM PST by Jeff Chandler (I shot Schroedinger's cat with Chekhov's gun.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: LibWhacker

After seeing my brother defeat leukemia twice, I’m always interested in seeing advancements in cancer fighting technologies. This is interesting to say the least.


5 posted on 01/04/2016 1:40:17 AM PST by SWAMP-C1PHER (HOMO, OECONOMIA, ET CIVITAS.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: 2ndreconmarine; Fitzcarraldo; Covenantor; Mother Abigail; EBH; Dog Gone; ...

Ping...


6 posted on 01/04/2016 1:48:03 AM PST by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tired of Taxes

Ping...


7 posted on 01/04/2016 1:54:08 AM PST by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: LibWhacker

Instead of drugs, take minerals to bolster your immune response. Of particular use is iodine, which facilitates apoptosis, the natural death of abnormal cells.


8 posted on 01/04/2016 3:48:51 AM PST by spacejunkie2001
[ Post Reply | Private Reply | To 1 | View Replies]

To: LibWhacker

Okay, so:

Step 1) Isolate the gene(s) necessary for cell migration and invasion. They may be homologous to the gene in C. elegans, but are probably more complex (more proteins involved, more control mechanisms).

Step 2) Develop drugs to target those genes, or if those genes cause markers to be expressed on the surfaces of those cells, target the markers. This is complicated by the fact that some normal cells—notably immune system cells—need to invade other tissues in order to function correctly. The big problem with cancer is that the treatment always hits normal cells in addition to the cancer cells.

Step 3) Assuming a drug to stop cell invasion is successfully developed, hit the cancer with a cocktail of drugs meant to stop invasion and growth at the same time.

This sounds like a new avenue against which to target cancer therapy, but it will not be a silver bullet. Cancer is too complex, and the difficulty of finding a therapy that targets the cancer and not healthy cells is nearly insurmountable. Also, it will be more than a decade before anything hits the market. And that is speaking optimistically.


9 posted on 01/04/2016 4:39:29 AM PST by exDemMom (Current visual of the hole the US continues to dig itself into: http://www.usdebtclock.org/)
[ Post Reply | Private Reply | To 1 | View Replies]

To: spacejunkie2001

Yes and supplement with magnesium and selenium to help the iodine do its job.


10 posted on 01/04/2016 5:00:14 AM PST by petercooper (Coexist my ass!)
[ Post Reply | Private Reply | To 8 | View Replies]

To: exDemMom; LibWhacker

These genes probably as well regulate how wounds are healed, so it might have bad side effects.


11 posted on 01/04/2016 5:31:10 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9 | View Replies]

To: LibWhacker

During the worm’s normal development, a cell known as the anchor cell breaks through a structure called the basement membrane, which initially separates the uterus from the vulva.....

As far as I know, the basement membrane separates the skin cells from the underlying tissue. An epithelial cancer is considered invasive when it has breached the basement membrane, which gives it access to the underlying tissue and allows it to metastasize all over the body. Most skin cancers initially metastasize through direct extension. I don’t know where the author got the info that the basement membrane separates the uterus from the vulva. And this is in the very respectable Scientific American? To me, this makes the entire premise suspect. And just a side comment......I was in cancer detection for decades and came to the conclusion that the Group/Person funding any research project WILL get the result they desire. Sad, but true.


12 posted on 01/04/2016 6:33:49 AM PST by originalbuckeye ("In a time of universal deceit, telling the truth is a revolutionary act." - George Orwell)
[ Post Reply | Private Reply | To 1 | View Replies]

To: petercooper

oh dang! you’re good :) I’m on the iodine protocol, which includes Iodoral, mag, selenium salt and vit c.

I think lots of ailments can be completed obliterated if people took minerals.


13 posted on 01/04/2016 6:53:16 AM PST by spacejunkie2001
[ Post Reply | Private Reply | To 10 | View Replies]

To: spacejunkie2001

Vitamin B17, found in apricot kernels, also causes apoptosis.


14 posted on 01/04/2016 7:01:30 AM PST by petercooper (Coexist my ass!)
[ Post Reply | Private Reply | To 13 | View Replies]

To: petercooper

I can’t take iodine (hashimotos)...wondering if I can take b17...interesting


15 posted on 01/04/2016 7:31:32 AM PST by goodnesswins (hey..Wussie Americans....ISIS is coming. Are you ready?)
[ Post Reply | Private Reply | To 14 | View Replies]

To: goodnesswins

http://www.amazon.com/Apricot-Power-Bitter-Raw-Seeds/dp/B0017JFDC8/ref=sr_1_4?ie=UTF8&qid=1451925673&sr=8-4&keywords=apricot+kernels

Read the reviews


16 posted on 01/04/2016 8:40:20 AM PST by petercooper (Coexist my ass!)
[ Post Reply | Private Reply | To 15 | View Replies]

To: petercooper; goodnesswins

Here is the brand I use. Like you said just read what people are saying.

http://www.amazon.com/gp/product/B0018OE2II?keywords=apricot%20seeds&qid=1451925896&ref_=sr_1_1&sr=8-1

I usually just grab a big handful an hour before bed time. I chew for about 10 minutes until it’s complete liquid (in order to activate it). Then I begin to swallow it.


17 posted on 01/04/2016 8:46:35 AM PST by Enlightened1
[ Post Reply | Private Reply | To 16 | View Replies]

To: spacejunkie2001

How do you take your iodine? It’s bit scary. From foods like seaweed, or one of the protocols?


18 posted on 01/04/2016 10:21:34 AM PST by Yaelle (Since PC is not actually "correct," it should be renamed Political Pandering.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: spacejunkie2001

I would love to hear details of your protocol. I have two different issues that sometimes lead to cancer and I’m all about diet and natural prevention.


19 posted on 01/04/2016 10:25:03 AM PST by Yaelle (Since PC is not actually "correct," it should be renamed Political Pandering.)
[ Post Reply | Private Reply | To 13 | View Replies]

To: petercooper

Wow, I am ordering these.


20 posted on 01/04/2016 10:33:27 AM PST by Yaelle (Since PC is not actually "correct," it should be renamed Political Pandering.)
[ Post Reply | Private Reply | To 16 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-53 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson