Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Exclusive: Inside the Military's Secret Undercover Army
newsweek.com ^ | 5/17/21 | WILLIAM M. ARKIN

Posted on 05/17/2021 10:30:51 PM PDT by ransomnote

click here to read article


Navigation: use the links below to view more comments.
first 1-2021-4041-48 next last
Hard to know which side this supposed secret force serves. The fact that the agency publishing information about it is Newsweek makes me think it can't be 'good news.'

Then again, the Pentagon refused to answer 'critical questions' asked by the incoming Biden administration, so it could be a nest of patriots.

What comes to mind is Obama's 'secret army'. Hopefully they are patriots, if Newsweek actually got this story right.

1 posted on 05/17/2021 10:30:51 PM PDT by ransomnote
[ Post Reply | Private Reply | View Replies]

To: ransomnote

A standing army of secret soldiers beholden to no one except their military overlords is exactly what my ancestors went to war with their English rulers over back 255 years ago.

Yup. Undoubtedly. The only way we can be “free”.


2 posted on 05/17/2021 10:49:17 PM PDT by Regulator (It's Fraud, Jim)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ransomnote

I have to assume Trump knows this.. or maybe not.


3 posted on 05/17/2021 10:50:25 PM PDT by pnut22
[ Post Reply | Private Reply | To 1 | View Replies]

To: ransomnote

Doubt they are patriots. More like thought police and the gang planting Critical Race Theory in the military, schools and businesses.

If they were patriots they wouldn’t have allowed Biden and company anywhere near the white house. Should be shot as spies of this illegitimate government, if out of uniform. Should be hanged as traitors if in uniform.

I’ve about had it with this government and its myriad spy organizations.


4 posted on 05/17/2021 10:51:19 PM PDT by HYPOCRACY
[ Post Reply | Private Reply | To 1 | View Replies]

To: ransomnote

Interesting, and a bit scary. Secrecy always triggers me. To whom is it accountable? I was surprised to see this in Newsweek also. It makes me wonder if it’s fake news or is this legit. Only the shadow knows.


5 posted on 05/17/2021 10:57:01 PM PDT by WWG1WWA (Beware the fury of a patient man. -John Dryden )
[ Post Reply | Private Reply | To 1 | View Replies]

To: ransomnote

Antifa, BLM, news media, various celebrities, etc...


6 posted on 05/17/2021 10:57:53 PM PDT by CivilWarBrewing (Get off my back for my usage of CAPS, especially you snowflake males! MAN UP!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ransomnote

This sound like what they call great skills. Highly secretive and nobody will talk about it. They use to recruit Intel soldiers now and then but the only thing they would tell us was that your still in the Army but you wear civilian clothes.


7 posted on 05/17/2021 11:03:03 PM PDT by 98charlie
[ Post Reply | Private Reply | To 1 | View Replies]

To: 98charlie

Maybe we should start accusing every diversity scumbag of being a spy for the military.

This is the way for them to keep the civilians from organizing.

Things would turn on them very quickly if a few got outed.


8 posted on 05/17/2021 11:15:38 PM PDT by HYPOCRACY
[ Post Reply | Private Reply | To 7 | View Replies]

To: HYPOCRACY

They all serve Satan.

Once one reviews their beliefs and behaviors, it’s as clear as daylight.

Whether they recognize who their supreme master is or not, it makes zero difference.

They truly are Satan’s children, and We The People are increasingly becoming aware of this fact.


9 posted on 05/17/2021 11:21:37 PM PDT by Prole ( )
[ Post Reply | Private Reply | To 4 | View Replies]

To: Prole

They all serve Satan.

Once one reviews their beliefs and behaviors, it’s as clear as daylight.
~~~~~~~~~~~~~
Not all. There are Christians in the military. When Biden presumed office, his people went to the Pentagon to lay hands on information withheld from Deep State actors. The Pentagon officials refused to answer their questions, at times pausing to consult what appeared to be a person functioning as an attorney. There is a core of the military that serves God and country.


10 posted on 05/17/2021 11:41:04 PM PDT by ransomnote (IN GOD WE TRUST)
[ Post Reply | Private Reply | To 9 | View Replies]

To: ransomnote

If it comes down to us vs them, quantity has a quality all of it’s own. There are millions of combat arms veterans like me, and if 10% of us take out one of them, they need millions rather than tens of thousands.

They lose. Bigly.


11 posted on 05/18/2021 12:03:02 AM PDT by datura
[ Post Reply | Private Reply | To 1 | View Replies]

To: 98charlie

Thanks. I’d never heard of it before. Interesting. :)


12 posted on 05/18/2021 12:05:02 AM PDT by ransomnote (IN GOD WE TRUST)
[ Post Reply | Private Reply | To 7 | View Replies]

To: ransomnote

The author of this article, William Arkin, is a notorious anti-American military leftist who has been associated with the Marxist/Rubin Foundation funded “Institute for Policy Studies”. See the very revealing book of the same name by S. Steven Powell, “Covert Cadre: Inside the Institute for Policy Studies”. (IPS).

Arkin was one of their Fellows and wrote for their created newspaper “In These Times”, now reportedly an “independent” leftist paper (but I wouldn’t trust them to tell the truth if they paid me).

Arkin was responsible for “exposing” supposed U.S. nuclear weapons sites in the U.S. (he says from public sources). References to him in “Covert Cadre” are found on pages 24, 90, 98, 269, 305, 343, 362, and references to this book (1985)”Nuclear Battlefields: Global Links in the Arms Race” is found on p. 91. This book (also written by Richard Fieldhouse, listed what they claimed were, from classified US secret documents. “what the authors believed are all American an allied nuclear weapons installations”.

Arkin, in 1984, was the source of secret classified documents on U.S. nuclear weapons/policies re our allies and he gave them to leftist New York Times writer, the slimy Leslie Gelf who wrote an article on Feb. 14, 1985, “U.S. Tries to Fight Allied Resistance to Nuclear Arms”.
Keywiki.org founder Trevor Loudon, back then in his native New Zealand, helped to expose the KGB operation/disinformation operation there which were the result of the Arkin 1984/Gelb article. From p. 90-91, in “Covert Cadre” is the following:

These stories struck a raw nerve in the alliance in the aftermath of the March 1985 action of Dave Lange, the prime minister of New Zealand (a far-left Soviet dupe, if not asset), who prohibited American warships carrying nuclear weapons from entering New Zealand’s water. As the navy refuses to comment on which of its ships carry stomic devices, the sanction effectively excluded all U.S. ships from the harbors of new Zealand, and subsequently led to the demise of the ANZUS alliance.”

Trevor find one of the KGB’s top assets in New Zealand and got exposed him as one of the leaders of the keep US ships out of New Zealand movement, the result of Arkin’s writings and Lange’s reactions to them.

Arkin was the “Second Coming” of fake Vietnam veteran Al Hubbard, one of the leaders of the leftist, then Marxist Vietnam Veterans Against the War in Vietnam (VVAW). Hubbard revealed that U.S. ships with nuclear weapons were visiting Japan, and the Japanese Reds (both Soviet/Red Chinese aligned parties, including the hardcore Marxist KGB-aided Japanese Socialist Party and their fronts, the Gensuiken and another one that sounded like it, possibly Gensuikaken), roared into action with massive protests.

Even when Hubbard was exposed as a fraud re Vietnam veteran , pilot, etc., the American and foreign media swallowed and regurgitated whatever he said. However, as more was learned about his communist contacts in the Soviet Union, Japan, and possibly No. Vietnam, he began to fade into obscurity and another leftist opportunist (Purple Heart 3 times fraud) named John Kerry arose in the leadership ranks of VVAW between 1971-late 72. See “Unfit for Command: Swiftboat Veterans for the Truth About John Kerry”, John O’Neill and Jerome Corsi, 2004, Regnery Publishing, for the first story, and then Swett & Ziegeler’s “To Set The Record Straight”, New American Media Publishing, 2008.

If their ever was a so-called “journalist” traitor in the American media, it would be Arkin, and he has never stopped trying to destroy our national defense systems/agencies.

Newsweek has given him a “home away from home” for his “writings”, and some Newsweek writers have become his co-writers, helpers. This would include Michael Isikoff, one of their top writers.

When you read something by Arkin, remember that he is not for America and never has been. His works prove it.


13 posted on 05/18/2021 12:05:31 AM PDT by MadMax, the Grinning Reaper
[ Post Reply | Private Reply | To 1 | View Replies]

Lovely.


14 posted on 05/18/2021 12:07:25 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ransomnote

This is just the normal process of the Left burning our Intelligence assets, once they get access to to the information. Here they lay out the sources and methods to be targeted, by foreign Intelligence services.

It happened after Obama was elected too. China rounded up and executed dozens, after Obama admin moles compromised them.

People will die, and be taken hostage, as a result of the Left taking power. Any new capabilities built up under Trump will be undermined, in service to the Chinese communists, who fund and support the Left’s power grabs.


15 posted on 05/18/2021 12:09:58 AM PDT by BeauBo
[ Post Reply | Private Reply | To 1 | View Replies]

To: MadMax, the Grinning Reaper

Thanks


16 posted on 05/18/2021 12:11:22 AM PDT by piasa (Attitude adjustments offered here free of charge)
[ Post Reply | Private Reply | To 13 | View Replies]

To: BeauBo

yep...burning assets.


17 posted on 05/18/2021 12:12:52 AM PDT by piasa (Attitude adjustments offered here free of charge)
[ Post Reply | Private Reply | To 15 | View Replies]

To: BeauBo

This was very bad “Report: Chinese hackers stole data from up to 4 million Federal Employees”
https://freerepublic.com/focus/f-news/3296974/posts?page=1


18 posted on 05/18/2021 12:17:10 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15 | View Replies]

To: MadMax, the Grinning Reaper

I’m grateful for your very informative post.


19 posted on 05/18/2021 12:25:19 AM PDT by ransomnote (IN GOD WE TRUST)
[ Post Reply | Private Reply | To 13 | View Replies]

To: ransomnote

Sounds like the American equivalent to the Soviet GRU. That was an intelligence branch of the Soviet Armed forces.


20 posted on 05/18/2021 12:27:52 AM PDT by Nateman (If the Left is not screaming , you are doing it wrong.)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-48 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson