[Michael_Michaelangelo]

So now we have the “punctuated equilibria” theory, which postulates that the fossil clock fluctuates wildly (long periods of stasis punctuated by rapid periods of evolution) and a wildly fluctuating molecular clock. Does anybody know what time it is? Course, problems with the molecular clocks *have* been reported before:

Erratic overdispersion of three molecular clocks: GPDH, SOD, and XDH

[delapaz]

Back to the old drawing board I guess...

[Michael_Michaelangelo]

Ping

[orionblamblam]

Science continues to self-correct with further information. Evolution remains the sole reasonable explanation of speciation, and is refined.

[Wonder Warthog]

"So now we have the “punctuated equilibria” theory, which postulates that the fossil clock fluctuates wildly (long periods of stasis punctuated by rapid periods of evolution) and a wildly fluctuating molecular clock."

These two hypotheses are NOT contradictory, and in fact tend to support one another. I would surmise that a variation in the "tick time" of the molecular/DNA clock is what controls "punctuated equilibrium".

My own take on the subject is that in times of increased stress, the rate of DNA change increases.

[Old Professer]

DNA mutates, and it's a good thing it does.

Don't disagree, you'll be banished to the cornfield. (Apologies to Rod Serling)

[Socratic]

“U” always follows “Q” and “B” never follows “V.”

I guess this guy never went to a musical revue. (Some may claim the gay gene derived from just such a pairing).

[bondserv]

"Vowles and Amos estimate that as much as 30% of the genome may show evidence of convergent evolution, simply because microsatellites are so common."

So genes are converging 30% of the time, that wreaks havoc on the idea that there is enough time for the divergent species we see.

Mantra: Long ago and far away we had 99% divergent evolution, despite what we see today.

This also brings incite to the idea that married people begin to look more alike. (-|;|Þ "Americans are just a bunch of cowboys".

[Ichneumon]

So now we have the “punctuated equilibria” theory, which postulates that the fossil clock fluctuates wildly (long periods of stasis punctuated by rapid periods of evolution)

That's not what the article says, try again.

and a wildly fluctuating molecular clock.

That's not what it says either.

Does anybody know what time it is?

Yes, but you might need some assistance.

Course, problems with the molecular clocks *have* been reported before:

...and are well known. That doesn't make them useless, however, as you and other creationists often try to imply. Why don't you leave science to people who know something about it?

[AndrewC]

Thus, if orangutans diverged from humans twice as long ago as did chimpanzees, on any given piece of DNA we would find twice as many differences between the orangutan sequence and the human sequence as between humans and chimps.

Thanks for the ping.

That statement is false, unless the "on any given piece of DNA" is changed to indicate DNA which would not be "adjusted".

[Ichneumon]

In English, “U” always follows “Q”

I'll bet twenty buqshas that isn't true.

[VadeRetro]

... the “punctuated equilibria” theory, which postulates that the fossil clock fluctuates wildly (long periods of stasis punctuated by rapid periods of evolution) ...

There's really no excuse for you still not knowing that punk-eek says about mutation rates. (Next to nothing.) No excuse. All you guys do is bludgeon with your own ignorance, forever.

[<1/1,000,000th%]

Creationists don't believe in DNA.

[nuconvert]

here ya go, Pong

[RightWingNilla]

It looks like the IDers found a new holy grail to go chasing after.

The caveats of relying on specific molecular clocks for precise sequence divergences have been known for years. The pattern of relationships are still remarkably similar between different methods overall (with the occasional outlier).

Reports like these lend no support to ID whatsoever. You guys would be better off looking for evidence of the flood.

[AndrewC]

You need a picture for some people.

Non-random base frequencies around microsatellites

[biblewonk]

DNA is not what scientists seem to think it is. It is not the building blocks of life, it is not the plans for building life forms. It is only a couple of switches for a couple of features in an otherwise much more complex machine.

[edsheppa]

This meant that mutations near microsatellites were not random, but favored certain letters in certain positions.

That conclusion seems unwarranted. At least from the information presented it seams equally reasonable to conclude that nearby DNA structures influence the probability of stuttering mutations.

[rmmcdaniell]

ATTAATACTGAACTCCTTATTGGTGAGAATACCGACGAGTCAATCGGAAACATAAGCAGCATTCTCCTCTATTAA

[cookcounty]

"DNA mutates, and it's a good thing it does. If it didn't, there could only be one kind of life,"

Whatever the merits of this article may be, the author at least admits in the first sentence that his a priori starting point is "God can't......."

[Tax Government]

I'd guess this means that clock speed and rate of evolution are subject to macro factors, like sun activity, thickness of the ozone layer, earthquakes/volcanism, presence in vicinity of comet/asteroid explosions...