Posted on 10/27/2005 3:07:32 AM PDT by Pharmboy
In a follow-up to the Human Genome Project, a consortium of scientists has compiled a partial catalog of human genetic variation that they hope will speed the search for the genetic roots of many common diseases.
The catalog is based on analyzing the genomes of people from four ethnic groups - Europeans, Japanese, Chinese and the Yoruba of Nigeria - and it has so far identified about three million sites on the three-billion-unit human genome where some people have different DNA units. These variations help make everyone unique, but they may also be the reason why people have propensities toward certain diseases.
The $138 million project was undertaken by about 200 researchers in six countries. About a third of the DNA variations were analyzed in the United States, a quarter each in Japan and Britain, and 10 percent each in China and Canada. The analysis of the variations, reported in today's issue of Nature, was done principally by Dr. David Altshuler of Massachusetts General Hospital and Dr. Peter Donnelly of the University of Oxford in England.
The catalog is intended to provide a shortcut through a frustrating medical problem. Many common diseases run in families, indicating that they have a genetic basis, but the genes involved have so far proved elusive. Unlike rare diseases, which tend to be caused by a single gene with a clear family pedigree, common diseases like cancer and diabetes probably spring from several predisposing variant genes, each of which has only a small effect and so is hard to pinpoint.
(Excerpt) Read more at nytimes.com ...
Pong...
bttt
Thanks. I don't think this is for the entire evolution ping list. But I've been wrong before.
And here's another point that always sticks in my craw: Aren't we always being told to "celebrate diversity"? So how come when diversity is pointed out, it somehow becomes evil and racist??
Ping...
I ping you to these 'cause I figure you'd be interested in seeing them, even if they don't make The Big Pongaroonie Evo List...
Wonderful! Where do I get a copy to browse through? And how can I place an order?
ATTGCATGCCTATGGCATTAGCCAATTTAGA
>>ATTGCATGCCTATGGCATTAGCCAATTTAGA
What's the shipping charge on a thing like that?
Microsopic.
Something serious for a change.
Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.