Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Study Challenges View on Aging Research [amazing implications]
Univ. So. Cal. Newsroom ^ | 17 November 2005 | Carl Marziali

Posted on 11/18/2005 4:05:32 AM PST by PatrickHenry

Deleting the ‘anti-aging’ gene from yeast greatly lengthens life span, say USC molecular scientists.

A counterintuitive experiment has resulted in one of the longest recorded life-span extensions in any organism and opened a new door for anti-aging research in humans.

Scientists have known for several years that an extra copy of the SIR2 gene can promote longevity in yeast, worms and fruit flies.

That finding was covered widely and incorporated into anti-aging drug development programs at several biotechnology companies.

Now, USC molecular geneticists suggest that SIR2 instead promotes aging.

Their study, titled “Sir2 Blocks Extreme Life-Span Extension,” appears in the Nov. 18 edition of the biology journal Cell. The lead author is Valter Longo, assistant professor in the Leonard Davis School of Gerontology and the USC College of Letters, Arts and Sciences.

Rather than adding copies of SIR2 to yeast, Longo’s research group deleted the gene altogether.

The result was a dramatically extended life spanup to six times longer than normal – when the SIR2 deletion was combined with caloric restriction and/or a mutation in one or two genes, RAS2 and SCH9, that control the storage of nutrients and resistance to cell damage.

Human cells with reduced SIR2 activity also appear to confirm that SIR2 has a pro-aging effect, Longo said, although those results are not included in the Cell paper.

Since all mammals share key aging-related genes, the paper points to a new direction for human anti-aging research.

Longo proposes that SIR2 and possibly its counterpart in mammals, SIRT1, may block the organism from entering an extreme survival mode characterized by the absence of reproduction, improved DNA repair and increased protection against cell damage. Organisms usually enter this mode in response to starvation.

The long-lived organisms in Longo’s experiment showed extraordinary resilience under stress.

“We hit them with oxidants, we hit them with heat,” Longo said. “They are highly resistant to everything. What they’re doing is basically saying, ‘I cannot afford to age. I still have to generate offspring, but I don’t have enough food to do it now.”

Longo predicted that as molecular geneticists master the levers of aging, they will be able to design drugs that coax the body into entering chosen aspects of a starvation-response mode, such as stress resistance, even when food is plentiful.

If enough food is available, an organism might be programmed both to reproduce normally and to maximize its survival systems.

Longo urged caution in extrapolating the result to humans.

“We have been very successful with simple organisms,” he said. “Naturally, mammals are complex, and it will be a great challenge to get major life-span extension.”

A “really exciting” implication, Longo said, is that cells may be able to speed up their DNA repair efforts. All organisms have the ability to repair harmful mutations in their DNA, whether caused by age, radiation, diet or other environmental factors. Cancer often begins when DNA mutations outstrip a cell’s ability to remain differentiated.

Many researchers believe DNA repair systems are already running flat out. The organisms in Longo’s experiment say otherwise.

[Deleting a few paragraphs from the end. Geeky stuff. The newsy implications are above.]


TOPICS: Culture/Society; Philosophy
KEYWORDS: aging; crevolist
Not quite a validation of intelligent design, but everyone be nice.
1 posted on 11/18/2005 4:05:32 AM PST by PatrickHenry
[ Post Reply | Private Reply | View Replies]

To: VadeRetro; Junior; longshadow; RadioAstronomer; Doctor Stochastic; js1138; Shryke; RightWhale; ...
Evolution Ping

The List-O-Links
A conservative, pro-evolution science list, now with over 320 names.
See the list's explanation, then FReepmail to be added or dropped.
To assist beginners: But it's "just a theory", Evo-Troll's Toolkit,
and How to argue against a scientific theory.

2 posted on 11/18/2005 4:06:46 AM PST by PatrickHenry (Expect no response if you're a troll, lunatic, retard, or incurable ignoramus.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: PatrickHenry
I cannot afford to age. I still have to generate offspring, but I don’t have enough food to do it now

That's what I tried telling my girlfriend, just before she hit the road.

3 posted on 11/18/2005 4:10:04 AM PST by Monti Cello
[ Post Reply | Private Reply | To 1 | View Replies]

To: PatrickHenry

"Longo urged caution in extrapolating the result to humans."

Appropriate name


4 posted on 11/18/2005 5:20:00 AM PST by SMARTY
[ Post Reply | Private Reply | To 1 | View Replies]

To: PatrickHenry

It would be ironic if the anti-aging genes also regulate weight. If, in nature, it is switch because of starvation, artificially inducing the switch would lead to a very, very long life, possibly with obesity as a result. In other words, you could live 300 years, but you have to be fat.


5 posted on 11/18/2005 5:32:28 AM PST by doc30 (Democrats are to morals what and Etch-A-Sketch is to Art.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: PatrickHenry
Not quite a validation of intelligent design,

Sure it is. When God created Adam and Eve, they lived for hundreds of years. Over time, due to sin, genetics deteriorated and shortened our life spans. There's no evidence here of accidental improvement in life span.

6 posted on 11/18/2005 6:24:20 AM PST by aimhigh
[ Post Reply | Private Reply | To 1 | View Replies]

To: aimhigh
When God created Adam and Eve, they lived for hundreds of years.

Why, is there evidence that the SIR 2 gene wasn't present in ancient humans?

Over time, due to sin, genetics deteriorated and shortened our life spans.

Genes don't just deteriorate. Mutations can be benificial or detrimental - and genetic complexity can increase in subsequent generations.

There's no evidence here of accidental improvement in life span.

Accidental, no. Do to better health practices, nutrition, sanitation, vaccinations, etc. our lifespan is longer than at any time in recorded history.

7 posted on 11/18/2005 7:17:28 AM PST by Quark2005 (Science aims to elucidate. Pseudoscience aims to obfuscate.)
[ Post Reply | Private Reply | To 6 | View Replies]

To: aimhigh
There's no evidence here of accidental improvement in life span.

Conversely, there's no evidence of an intentional improvement in life span as well.

8 posted on 11/18/2005 7:49:49 AM PST by elbucko
[ Post Reply | Private Reply | To 6 | View Replies]

To: Quark2005; aimhigh
When God created Adam and Eve, they lived for hundreds of years.

Why, is there evidence that the SIR 2 gene wasn't present in ancient humans?

I would be interested if the SIR 2 gene is also present in the chimpanzee. If it is, maybe it's God's way of indicating that ID is bunk and Evo is the path to knowledge. Just a thought.

9 posted on 11/18/2005 7:55:07 AM PST by elbucko
[ Post Reply | Private Reply | To 7 | View Replies]

To: PatrickHenry

I hope I never see the day when people can arbitrarily extend their life spans to many times their natural length.


10 posted on 11/18/2005 8:07:16 AM PST by spinestein (Forget the Golden Rule. Follow the Brazen Rule.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: doc30

That would be a sad irony and a difficult choice for Paris Hilton I'm sure!


11 posted on 11/18/2005 8:16:47 AM PST by GOPPachyderm
[ Post Reply | Private Reply | To 5 | View Replies]

To: PatrickHenry
So maybe we could live six times as long if we forced our bodies into this extreme crisis mode and simulated starvation and other extreme stresses upon ourselves. Or maybe it would just seem like six times as long.

I'm not gonna try it. Let's get Mikey to try it.

12 posted on 11/18/2005 8:32:05 AM PST by VadeRetro (Liberalism is a cancer on society. Creationism is a cancer on conservatism.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Quark2005
Why, is there evidence that the SIR 2 gene wasn't present in ancient humans?

Why, yes. I recently concluded a complete DNA analysis of both Adam and Eve, and there is evidence that the "SIR 2" gene was a mutation resulting from an apple they'd eaten that had some really nasty toxins in it.

The SIR 2 gene allowed them to live, but their life became butal, nasty, and short.

HAND

13 posted on 11/18/2005 8:37:25 AM PST by zeugma (Warning: Self-referential object does not reference itself.)
[ Post Reply | Private Reply | To 7 | View Replies]

To: elbucko
If it is, maybe it's God's way of indicating that ID is bunk and Evo is the path to knowledge.

I don't think the idea of an "intelligent designer" is bunk, I just think it is bunk science.

In any case, if we could prove the gene was absent in early humans, it might the beginning of research indicating that people once actually did live longer (more analysis would be needed, of course...) All wildly speculative musings, though, at this point.

14 posted on 11/18/2005 8:40:31 AM PST by Quark2005 (Science aims to elucidate. Pseudoscience aims to obfuscate.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Quark2005
I don't think the idea of an "intelligent designer" is bunk, I just think it is bunk science.

We agree. I stand corrected.

15 posted on 11/18/2005 8:59:32 AM PST by elbucko
[ Post Reply | Private Reply | To 14 | View Replies]

To: PatrickHenry
Very interesting. Wonder if these guys will take a shot at the Mprize.
16 posted on 11/18/2005 9:05:12 AM PST by ThinkDifferent (I am a leaf on the wind)
[ Post Reply | Private Reply | To 1 | View Replies]

To: spinestein
I hope I never see the day when people can arbitrarily extend their life spans to many times their natural length.

Why?

17 posted on 11/18/2005 10:24:30 AM PST by JeffAtlanta
[ Post Reply | Private Reply | To 10 | View Replies]

To: JeffAtlanta
Death is necessary to make room for new life. Old people die to make room for young people, who bring with them new ideas and risk taking and vitality.

I would speculate that if a large percentage of humanity had the ability to extend their lives (to perhaps 500 years old) then the young people they would have to prevent from being born wouldn't be around to contribute those beneficial traits, leading to a stagnation of society.

I think this has already happened to a certain extent since the ability of modern medicine to extend people's lives to about 80 years, more than double what it used to be.

Of course I accept the benefits of modern preventive medicine and disease control for myself and everybody else who wants it, but if someone offered me a pill that would allow me to live to the age of 500 there is NO WAY I would take it.
18 posted on 11/18/2005 12:26:34 PM PST by spinestein (Forget the Golden Rule. Follow the Brazen Rule.)
[ Post Reply | Private Reply | To 17 | View Replies]

To: Quark2005
Do to better health practices, nutrition, sanitation, vaccinations, etc. our lifespan is longer than at any time in recorded history.

The bible record has longer lifespans. But then you reject some recorded history.

19 posted on 11/18/2005 12:29:34 PM PST by aimhigh
[ Post Reply | Private Reply | To 7 | View Replies]

To: spinestein

I demand you take the pill and join AARP!


20 posted on 11/18/2005 12:30:23 PM PST by bvw
[ Post Reply | Private Reply | To 18 | View Replies]

To: VadeRetro

So maybe we could live six times as long if we forced our bodies into this extreme crisis mode and simulated starvation



I wish I had read this before lunch


21 posted on 11/18/2005 12:34:44 PM PST by Taffini (Mr. Pippin and Mr. Waffles do not approve)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Taffini
I don't know. You diddle your genes and starve yourself.

Even if you only lived the same time, it would seem like six times as long. If you did live six times as long, it would seem like 36 times as long, or like you died and went to Hell.

22 posted on 11/18/2005 12:38:49 PM PST by VadeRetro (Liberalism is a cancer on society. Creationism is a cancer on conservatism.)
[ Post Reply | Private Reply | To 21 | View Replies]

To: PatrickHenry

Don't fall for it! It is an enviromentalists scheme to rid the earth of people. :-)


23 posted on 11/18/2005 12:45:12 PM PST by Mind-numbed Robot (Not all that needs to be done needs to be done by the government.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: VadeRetro

Even if you only lived the same time, it would seem like six times as long. If you did live six times as long, it would seem like 36 times as long, or like you died and went to Hell.




and worse, what if you lived 36x longer and it seemed like Hell as you say, then you died and actually went to hell...I call that loose, loose

I should have had the extra fries at lunch


24 posted on 11/18/2005 1:18:41 PM PST by Taffini (Mr. Pippin and Mr. Waffles do not approve)
[ Post Reply | Private Reply | To 22 | View Replies]

To: VadeRetro
I don't know. You diddle your genes and starve yourself.

Even if you only lived the same time, it would seem like six times as long. If you did live six times as long, it would seem like 36 times as long, or like you died and went to Hell.

I doubt that it'd actually feel like you were starving. I for one would take the pill. (As long as my body wasn't 6 times more frail than I would be at age 80 anyway!) But I don't think that's what happens in these cases. The very old animals in these tests look & act like they were in the prime of their lives, right up until the end.
25 posted on 11/18/2005 5:16:25 PM PST by jennyp (WHAT I'M READING NOW: Art of Unix Programming by Raymond)
[ Post Reply | Private Reply | To 22 | View Replies]

To: jennyp
You make it sound pretty good. I could cut down a little on the homages to the Flying Spaghetti Monster, but the beer and wine ration goes no lower!
26 posted on 11/18/2005 5:20:37 PM PST by VadeRetro (Liberalism is a cancer on society. Creationism is a cancer on conservatism.)
[ Post Reply | Private Reply | To 25 | View Replies]

To: VadeRetro
You make it sound pretty good. I could cut down a little on the homages to the Flying Spaghetti Monster, but the beer and wine ration goes no lower!

LOL, my 85-year old mom insists on a glass of good wine with dinner. But only because of the health benefits, of course. My 88-year old dad is happy to go along with that.

27 posted on 11/18/2005 5:25:12 PM PST by jennyp (WHAT I'M READING NOW: Art of Unix Programming by Raymond)
[ Post Reply | Private Reply | To 26 | View Replies]

To: jennyp
They must be doing OK. My Mom now 83 used to like a glass of wine in the evening but she's been totally prohibited for years after heart trouble, colon surgeries, etc. Lost Dad some years back at age 80 due to progressive heart failure.
28 posted on 11/18/2005 5:35:02 PM PST by VadeRetro (Liberalism is a cancer on society. Creationism is a cancer on conservatism.)
[ Post Reply | Private Reply | To 27 | View Replies]

To: PatrickHenry

Another article:

http://www.freerepublic.com/focus/f-news/1524957/posts?page=7#comment


29 posted on 11/18/2005 6:43:32 PM PST by phantomworker (A new day! Begin it serenely; with too high a spirit to be encumbered with your old nonsense!)
[ Post Reply | Private Reply | To 2 | View Replies]

Comment #30 Removed by Moderator

To: AGTTGTATTGAAAACACTATCTCAACG
I hope I never see the day when people can arbitrarily extend their life spans to many times their natural length.

No kidding. If you thought useless welfare deadbeats are bad now, just wait until its a "civil right" for them to hang around and leech off of the rest of us forever.

That's right about perpetuating the deadbeats of society!

I "had" to watch a movie on the plane yesterday morning, called "Island". They produced clones to replace organs and tissue of "real" people. Only cost $6 million per clone. But, wouldn't you know it, the clones revolted!!! ROFL!

31 posted on 11/18/2005 7:03:50 PM PST by phantomworker (A new day! Begin it serenely; with too high a spirit to be encumbered with your old nonsense!)
[ Post Reply | Private Reply | To 30 | View Replies]

To: spinestein
...if someone offered me a pill that would allow me to live to the age of 500 there is NO WAY I would take it.

Well, I understand completely. Seriously. When the time comes please ping me and I will be happy to take that pill off your hands!

32 posted on 11/18/2005 7:22:38 PM PST by AntiGuv (™)
[ Post Reply | Private Reply | To 18 | View Replies]

To: PatrickHenry

Cool! So I'm NOT wasting precious life on FR--there's so much more to come than I realized!


33 posted on 11/18/2005 7:24:55 PM PST by John Robertson ( Safe Travel)
[ Post Reply | Private Reply | To 1 | View Replies]

To: aimhigh
Not quite a validation of intelligent design . . .

Sure it is. When God created Adam and Eve, they lived for hundreds of years. Over time, due to sin, genetics deteriorated and shortened our life spans. There's no evidence here of accidental improvement in life span.

Oh please. The Bible is not a scientific paper. The Old Testament was written approximately 2500 years ago. There is no mention of evolution, airplanes, computers, or football. As Krauthammer wrote today, why do some people create a conflict between science and religion, when none need exist?

34 posted on 11/18/2005 11:34:31 PM PST by Maynerd
[ Post Reply | Private Reply | To 6 | View Replies]

To: AntiGuv

What would you envision yourself doing at the age of 450, assuming you would live naturally for a further 50 years after that?


35 posted on 11/20/2005 11:44:27 AM PST by spinestein (Forget the Golden Rule. Follow the Brazen Rule.)
[ Post Reply | Private Reply | To 32 | View Replies]

To: aimhigh
Sure it is. When God created Adam and Eve, they lived for hundreds of years. Over time, due to sin, genetics deteriorated and shortened our life spans.

Okay, I'll bite: How did "genetic deterioration" *add* a gene?

For that matter, how does "sin" cause "genetic deterioration"?

And how did "sin" add this same gene to most (perhaps all) eukaryotic organisms? Does "genetic deterioration" add the same gene to millions of life forms at the same time?

I think your thesis needs work.

36 posted on 11/20/2005 12:00:50 PM PST by Ichneumon
[ Post Reply | Private Reply | To 6 | View Replies]

To: spinestein; AntiGuv; PatrickHenry
What would you envision yourself doing at the age of 450, assuming you would live naturally for a further 50 years after that?

Yelling at those 300-year-old whippersnappers, telling them to get off my lawn!

37 posted on 11/20/2005 12:01:57 PM PST by Ichneumon
[ Post Reply | Private Reply | To 35 | View Replies]

To: spinestein; Ichneumon; PatrickHenry
What would you envision yourself doing at the age of 450, assuming you would live naturally for a further 50 years after that?

Debiting my universal account for whatever treatment will keep me alive 500 more.

38 posted on 11/20/2005 2:36:44 PM PST by AntiGuv (™)
[ Post Reply | Private Reply | To 35 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson