Skip to comments.
The Washington Post Reveals 'Top Secret America'
Atlantic Wire ^
| Max Fisher
Posted on 07/19/2010 9:03:05 AM PDT by lbryce
click here to read article
Navigation: use the links below to view more comments.
first previous 1-20, 21-24 last
To: lbryce
This piece is clearly written with a far-left bias. I have many doubts about it's authenticity
However, that being said, the nature of growth described is in the very DNA of bureaucracies. Give someone a title and he must build a kingdom. Look at the Social Security System, Obamacare, Medicare - look at any of them. They are all bloated with unnecessary people. And, sadly most now have a union to protect them and their jobs and reduction in force is next to impossible.
21
posted on
07/19/2010 10:20:13 AM PDT
by
elpadre
(AfganistaMr Obama said the goal was to "disrupt, dismantle and defeat al-Qaeda" and its allies.)
To: Buckeye McFrog; gandalftb; Saberwielder; SunkenCiv
For example, 51 federal organizations and military commands, operating in 15 U.S. cities, track the flow of money to and from terrorist networks.
That should be reduced to two. 900 000 with TS clearance is ridiculous, they will only spend their time reading reports and participating in meetings.
Merge many agencies and then cut the total budget by 2/3, forbid them to write paper reports, put everything in Intellipedia.
22
posted on
07/19/2010 10:28:40 AM PDT
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: Buckeye McFrog
Well, you figure about half of them, or more, either WEAR the uniform of our Armed Forces, or used to wear one. Right there, it puts the numbers in perspective. . .
23
posted on
07/19/2010 10:31:58 AM PDT
by
Salgak
(Acme Lasers presents: The Energizer Border: I dare you to try and cross it. . .)
To: lbryce
Seems to be a running theme here with the 4th Branch 5th Columnists, when they need to run cover for their leftist Friends of Government. So I will say it again;
Imagine that, the WaPo complaining about the same Homo-Leninists who they covet and cover while participating in the political class status racketeering just to keep their jobs.
Thats rich, Beltway Boys pretending not to be Butt-boys on the Potomac.
24
posted on
07/19/2010 3:07:50 PM PDT
by
ntmxx
(I am not so sure about this misdirection!)
Navigation: use the links below to view more comments.
first previous 1-20, 21-24 last
Disclaimer:
Opinions posted on Free Republic are those of the individual
posters and do not necessarily represent the opinion of Free Republic or its
management. All materials posted herein are protected by copyright law and the
exemption for fair use of copyrighted works.
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson