Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

The Washington Post Reveals 'Top Secret America'
Atlantic Wire ^ | Max Fisher

Posted on 07/19/2010 9:03:05 AM PDT by lbryce

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-24 last
To: lbryce
This piece is clearly written with a far-left bias. I have many doubts about it's authenticity

However, that being said, the nature of growth described is in the very DNA of bureaucracies. Give someone a title and he must build a kingdom. Look at the Social Security System, Obamacare, Medicare - look at any of them. They are all bloated with unnecessary people. And, sadly most now have a union to protect them and their jobs and reduction in force is next to impossible.

21 posted on 07/19/2010 10:20:13 AM PDT by elpadre (AfganistaMr Obama said the goal was to "disrupt, dismantle and defeat al-Qaeda" and its allies.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Buckeye McFrog; gandalftb; Saberwielder; SunkenCiv
For example, 51 federal organizations and military commands, operating in 15 U.S. cities, track the flow of money to and from terrorist networks.

That should be reduced to two. 900 000 with TS clearance is ridiculous, they will only spend their time reading reports and participating in meetings.

Merge many agencies and then cut the total budget by 2/3, forbid them to write paper reports, put everything in Intellipedia.
22 posted on 07/19/2010 10:28:40 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17 | View Replies]

To: Buckeye McFrog

Well, you figure about half of them, or more, either WEAR the uniform of our Armed Forces, or used to wear one. Right there, it puts the numbers in perspective. . .


23 posted on 07/19/2010 10:31:58 AM PDT by Salgak (Acme Lasers presents: The Energizer Border: I dare you to try and cross it. . .)
[ Post Reply | Private Reply | To 17 | View Replies]

To: lbryce

Seems to be a running theme here with the 4th Branch 5th Columnists, when they need to run cover for their leftist “Friends of Government.” So I will say it again;

Imagine that, the WaPo complaining about the same Homo-Leninists who they covet and cover while participating in the political class status racketeering just to keep their jobs.

That’s rich, Beltway Boys pretending not to be Butt-boys on the Potomac.


24 posted on 07/19/2010 3:07:50 PM PDT by ntmxx (I am not so sure about this misdirection!)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-24 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson