Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

2nd rocket still at N. Korea's launch site after failed launch(spare rocket available for launch)
Mainichi ^ | 04/20/12

Posted on 04/20/2012 5:02:24 AM PDT by TigerLikesRooster

2nd rocket still at N. Korea's launch site after failed launch

SEOUL (Kyodo) -- Another rocket is still at the North Korean launch site from where the North attempted to launch a rocket carrying what it said was a satellite last Friday, raising speculation the North may attempt yet another launch, a South Korean government source told Kyodo News on Friday.

North Korea moved two rockets to the launch site in Tongchang-ri near the northern border with China on March 23 from a factory in Pyongyang and the second, believed to be of the same type of the one blasted off last week, is still in an assembly facility in the site, the source said.

North Korea's attempt last week ended in failure when the rocket exploded barely a minute into flight.

Some experts now believe the very public failure of North Korean rocketry may prompt it to try to save face through a third nuclear weapons test soon.

North Korea's previous two nuclear weapons tests came relatively soon after failed rocket launches. . April 20, 2012(Mainichi Japan)


TOPICS: Foreign Affairs; News/Current Events
KEYWORDS: nkorea; rocket
More to come: another rocket and a nuke.
1 posted on 04/20/2012 5:02:28 AM PDT by TigerLikesRooster
[ Post Reply | Private Reply | View Replies]

To: TigerLikesRooster; AmericanInTokyo; Steel Wolf; nuconvert; MizSterious; nw_arizona_granny; ...

P!


2 posted on 04/20/2012 5:03:20 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

They’ve got to smuggle in another Bic lighter to set it off.


3 posted on 04/20/2012 5:20:00 AM PDT by SWAMPSNIPER (The Second Amendment, a Matter of Fact, Not a Matter of Opinion)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster
Maybe this one will accidentally fall out of the sky also. wink wink!
4 posted on 04/20/2012 5:25:40 AM PDT by Dusty Road
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster
...raising speculation the North may attempt yet another launch...

That wouldn't be too smart - unless. If the NKs believe they know, and I mean know for certain what went wrong last week...and they are certain that won't apply to this other rocket which is apparently the same design and configuration... Ok, then I could see trying again. But if they are not sure, they should do far more analysis to figure out what went wrong. If it is a fundamental design inadequacy (eg. structural) then they had better make a change before turning their next expensive piece of gear into fireworks.

...the second, believed to be of the same type of the one blasted off last week, is still in an assembly facility in the site...

It will be very telling if they do launch again relatively soon - within several weeks. That's really not enough time figure out what went wrong, how to correct it, implement the change, and then verify that'll work/review it/test it before the flight. Unless it was something glaringly obvious and simple to correct... But in general (ie. general Murphy and his law with all its corollaries) engineers don't get that lucky.

It also begs the question... Do they just happen to have another "weather satellite" handy to try orbiting again? Or was the payload something else, a something relatively unsophisticated and cheap - like a simple dead weight dummy warhead?

If they launch again soon I would say it smacks more of a political statement to their citizenry, friends and foes rather than a part of some engineering development program.

5 posted on 04/20/2012 5:38:53 AM PDT by ThunderSleeps (Stop obama now! Stop the hussein - insane agenda!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dusty Road

You know what would be funny as heck - if one of these hacker groups that is always running around causing trouble on the net did it, or could do it. Picture them on youtube flowing around in the Yellow Sea on a fishing trawler with a big dish antenna and some gear. “Now watch folks as the dish tracks the rocket...hear that, that’s us locked in to their telemetry transmitter - so the dish is following the rocket. We at {xyz} object to weapons of war, so we’ve hacked into the North Korean computers and found the command destruct radio sequence. It goes just ... like ... this ... {sound of warbled/encoded tone from computer speakers and}...” Instant fireworks.


6 posted on 04/20/2012 5:44:35 AM PDT by ThunderSleeps (Stop obama now! Stop the hussein - insane agenda!)
[ Post Reply | Private Reply | To 4 | View Replies]

To: TigerLikesRooster

Their mission control look like a jr. high computer room!


7 posted on 04/20/2012 5:55:55 AM PDT by Dr. Ursus
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

The North Koreans are such spoil sports, they renamed their crappy rockets “Unha”. I prefered the old “Nodong” rockets, because when they failed the jokes just wrote themselves.


8 posted on 04/20/2012 6:11:43 AM PDT by apillar
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dr. Ursus

I’ve been to the KSC and Houston. Their original mission control rooms did not look much more advanced. And we put a man on the moon.

Just saying....


9 posted on 04/20/2012 6:31:37 AM PDT by Vermont Lt (I just don't like anything about the President. And I don't think he's a nice guy.)
[ Post Reply | Private Reply | To 7 | View Replies]

To: TigerLikesRooster

I wonder what happened to the scientists and engineers held responsible for the first rocket failure? Were they trundled off for “self criticism” sessions or sent directly to a gulag along with their families?


10 posted on 04/20/2012 6:58:20 AM PDT by The Great RJ
[ Post Reply | Private Reply | To 1 | View Replies]

To: apillar
they renamed their crappy rockets “Unha”. I prefered the old “Nodong” rockets, because when they failed the jokes just wrote themselves.

The name came from when they told the Chinese they were going to launch an ICBM made entirely in North Korea. The other guy just said "Unha; I'm sure that's going to end well."
11 posted on 04/20/2012 7:19:27 AM PDT by GonzoGOP (There are millions of paranoid people in the world and they are all out to get me.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: TigerLikesRooster; AmericanInTokyo
Perhaps a “rocket first”-principle April 19, 2012:

Scientists and technicians of the DPRK have already wound up the specific and scientific probe into the cause of Kwangmyongsong-3's failure to enter its orbit.

All the scientific and technological data and precious experience gained this time will serve as a very precious boon to space development and a reliable guarantee for greater success in the days ahead.

The world will clearly know how the struggle for justice and truth for protecting sovereignty will be crowned with victory, while watching dignified satellites of the DPRK being put into vast space one after another.

No matter how loudly the U.S. and Japanese reactionaries and their followers may cry and no matter how frantically the Lee Myung Bak group of rats may squeak, the DPRK’s satellites for peaceful purposes will be put into space one after another.

http://www.kcna.co.jp/item/2012/201204/news19/20120419-34ee.html

Q: Have they started the injection of liquid fuel for the second rocket yet? /p

12 posted on 04/20/2012 9:07:46 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

Hey Tiger maybe I could get my mom send my brother rocket set to NK just in case LOL!


13 posted on 04/20/2012 1:31:03 PM PDT by SevenofNine (We are Freepers, all your media belong to us ,resistance is futile)
[ Post Reply | Private Reply | To 2 | View Replies]

To: TigerLikesRooster; AmericanInTokyo; gandalftb

Discussion about the missile and the transporter erector launcher (TEL):

DPRK ICBM Items
http://lewis.armscontrolwonk.com/archive/5150/dprk-icbm-items

and a Launch Vehicle Performance Calculator for the next(?) launch: http://www.silverbirdastronautics.com/LVperform.html


14 posted on 04/23/2012 1:22:05 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson