Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

'Dead, wounded' on both sides in east Ukraine police raid
AFP via Yahoo! ^

Posted on 04/13/2014 3:45:10 AM PDT by wetphoenix

Kiev (AFP) - Ukraine's interior minister said on Sunday that both sides had suffered casualties during a raid launched by Ukrainian special forces on a police station in the eastern city of Slavyansk that was seized by pro-Russian gunmen.

"There are dead and wounded on both sides. On our side -- an SBU (Ukrainian Security Service) officer. The head of the SBU's anti-terrorist centre has been wounded, as have four others," Interior Minister Arsen Avakov wrote on his Facebook page.

"On side of the separatists -- an unidentified number. The separatists have started to protect themselves using human shields."

Avakov added that Ukraine's special forces have begun to "regroup" but he gave no other details.

About 20 pro-Kremlin gunmen on Saturday seized the Slavyansk police station and later occupied the city's SBU security service building.

The raids were accompanied by unconfirmed reports of police stations in other nearby cities in the heavily Russified east of the country also falling under gunmen's control.

Video footage aired on Ukrainian television showed gunmen opening fire on Saturday during a raid on a police station in the nearby town of Kramatorsk.

Ukraine's interior ministry had on Saturday denied that the Kramatorsk police station had also been taken by the armed separatists.

Avakov only said in his Facebook posting that "the people of Kramatorsk are unhappy with the actions of the invaders".

The east of Ukraine has been rocked by protests demanding that the region stage referendums on joining Kremlin rule similar to the one that led to Crimea's annexation by Russia last month.

(Excerpt) Read more at news.yahoo.com ...


TOPICS: Breaking News; Crime/Corruption; Culture/Society; Foreign Affairs; News/Current Events; Russia
KEYWORDS: biden; russia; ukraine
Navigation: use the links below to view more comments.
first 1-5051-59 next last

1 posted on 04/13/2014 3:45:10 AM PDT by wetphoenix
[ Post Reply | Private Reply | View Replies]

To: wetphoenix

And all because of a coup....several months before a true democratic election.


2 posted on 04/13/2014 3:53:06 AM PDT by Sacajaweau
[ Post Reply | Private Reply | To 1 | View Replies]

To: Sacajaweau

They tried to escape a very intelligent, very ruthless, dictator and are failing. A very sad reminder that in real life evil can triumph over good. I will pray for Ukraine.


3 posted on 04/13/2014 4:16:28 AM PDT by BurningOak (http://www.freerepublic.com/focus/f-news/2830849/reply?c=1)
[ Post Reply | Private Reply | To 2 | View Replies]

To: wetphoenix

I wander if it is OK to send troops against your own people - will that be repeated in US by present regime?

West looks more and more like USSR in 50es and 60es - staging coups, denouncing God and sending the troops if people want freedom.... against people.


4 posted on 04/13/2014 4:18:40 AM PDT by kronos77 (Kosovo is Serbian Jerusalem. No Serbia without Kosovo.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BurningOak

So it starts...How will it end?


5 posted on 04/13/2014 4:42:41 AM PDT by Forward the Light Brigade (Into the Jaws of H*ll)
[ Post Reply | Private Reply | To 3 | View Replies]

To: wetphoenix
Uh oh Russia. Here comes another "warning."


6 posted on 04/13/2014 4:45:30 AM PDT by SkyPilot
[ Post Reply | Private Reply | To 1 | View Replies]

To: wetphoenix
Sounds like Kiev a month or two ago.
7 posted on 04/13/2014 5:06:10 AM PDT by McGruff (I wouldn't be surprised if Jeb Bush pulled a Charlie Crist)
[ Post Reply | Private Reply | To 1 | View Replies]

To: wetphoenix

At least the good guys won in Nevada!


8 posted on 04/13/2014 5:21:24 AM PDT by 2harddrive
[ Post Reply | Private Reply | To 1 | View Replies]

To: kronos77
I wander if it is OK to send troops against your own people - will that be repeated in US by present regime?

It happened during the Civil War. A million dead on both sides.

9 posted on 04/13/2014 5:51:39 AM PDT by Zhang Fei (Let us pray that peace be now restored to the world and that God will preserve it always.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: McGruff
Sounds like Kiev a month or two ago.

Protestors in Kiev got their way after a hundred unarmed demonstrators were shot down. These folks are starting out with automatic weapons, and maybe more. Putting down armed insurrection is one of the basic functions of government.

10 posted on 04/13/2014 5:55:14 AM PDT by Zhang Fei (Let us pray that peace be now restored to the world and that God will preserve it always.)
[ Post Reply | Private Reply | To 7 | View Replies]

To: McGruff

So if an ELECTED Ukrainian government killing people who built barricades, took over buildings, and worked to overthrow the government was bad...

How come now an UNELECTED Ukrainian government killing people who build barricades, take over buildings, and work to overthrow the government is ok?

Both sides suck in this conflict, but the hypocrisy of some people is really amazing.


11 posted on 04/13/2014 5:55:28 AM PDT by icwhatudo (Low taxes and less spending in Sodom and Gomorrah is not my idea of a conservative victory)
[ Post Reply | Private Reply | To 7 | View Replies]

To: Sacajaweau
And all because of a coup....several months before a true democratic election.

Given that Yanukovich did away with freedom of speech and freedom of assembly while setting himself up as dictator-for-life, I would call it a revolt that reversed his coup.

12 posted on 04/13/2014 5:58:45 AM PDT by Zhang Fei (Let us pray that peace be now restored to the world and that God will preserve it always.)
[ Post Reply | Private Reply | To 2 | View Replies]

Comment #13 Removed by Moderator

To: Zhang Fei

1776?


14 posted on 04/13/2014 6:23:55 AM PDT by kronos77 (Kosovo is Serbian Jerusalem. No Serbia without Kosovo.)
[ Post Reply | Private Reply | To 10 | View Replies]

To: BurningOak

I know! It is tragic! It is supposed to work out like this, EVERY TIME! Moscow trash! Subhuman mongoloids! IT IS SUPPOSED TO BE LIKE THIS, EVERY TIME:

https://www.youtube.com/watch?v=F5GeBpZ5VHY


15 posted on 04/13/2014 6:42:19 AM PDT by Psalm 144 (FIGHT! FIGHT! SEVERE CONSERVATIVE AND THE WILD RIGHT!)
[ Post Reply | Private Reply | To 3 | View Replies]

To: kronos77

The west even tries to impose an overarching ‘Internationale’. Globalism, New World Order or ‘citizen of the world’ rhetoric, but the point is that national identities and independence are all supposed to be folded into ‘the greater good’.


16 posted on 04/13/2014 6:58:04 AM PDT by Psalm 144 (FIGHT! FIGHT! SEVERE CONSERVATIVE AND THE WILD RIGHT!)
[ Post Reply | Private Reply | To 4 | View Replies]

To: McGruff
Sounds like Kiev a month or two ago.

Really?

Russian destabilization forces where in Kiev a month or two ago attempting to annex against the will of the people a part of a sovereign country, Ukraine?

17 posted on 04/13/2014 7:18:07 AM PDT by FreeReign
[ Post Reply | Private Reply | To 7 | View Replies]

To: 2harddrive
At least the good guys won in Nevada!

We had one of the Putin defenders yesterday making the claim that the efforts of Bundy and friends were similar to the efforts of Putin and his destabilization efforts in E. Ukraine.

I kid you not.

18 posted on 04/13/2014 7:23:39 AM PDT by FreeReign
[ Post Reply | Private Reply | To 8 | View Replies]

To: FreeReign

where —> were


19 posted on 04/13/2014 7:24:42 AM PDT by FreeReign
[ Post Reply | Private Reply | To 17 | View Replies]

To: wetphoenix

The Berkut were supposed to be disbanded. People in eastern Ukraine can see with their own eyes its a lie. And this will only deepen the divide between the East and Kiev which was never good to begin with even in the good times - even wider. With the loss of trust and goodwill, it makes the crisis that much harder to resolve.

Its a major step backwards.


20 posted on 04/13/2014 7:48:11 AM PDT by goldstategop (In Memory Of A Dearly Beloved Friend Who Lives In My Heart Forever)
[ Post Reply | Private Reply | To 1 | View Replies]

To: wetphoenix

Now that the interim president of Ukraine has sent in the tanks and artillery, and a full-scale civil war has erupted, it’s unlikely that the Ukrainians will be able to vote in a few months, as scheduled, to choose a democratically elected president.

The interim president will declare martial law as the blood flows in the streets, and no elections will take place. The interim president will then become a permanent dictator until he decides to allow Ukraine’s eastern Russian-speaking provinces to choose through referendums whether they want to join Russia or remain in bloody, war-torn Ukraine under a dictator.

The interim president should allow such referendums to go forward now; he should have done so before he allowed the first tank to enter Ukrainian streets. And while the blood is flowing, the natural gas won’t be, as Russia is likely to cut of Ukraine’s supply through pipes that also supply Europe.


21 posted on 04/13/2014 7:50:09 AM PDT by Bluestocking
[ Post Reply | Private Reply | To 1 | View Replies]

To: Bluestocking
Now that the interim president of Ukraine has sent in the tanks and artillery...

You really don't know what you are talking about.

22 posted on 04/13/2014 7:52:52 AM PDT by FreeReign
[ Post Reply | Private Reply | To 21 | View Replies]

To: FreeReign

“Russian destabilization forces where in Kiev a month or two ago”

Really?
US and Open Society Destabilization forces were in Kiev long before that. Problem is, the people they backed can’t govern.


23 posted on 04/13/2014 9:23:18 AM PDT by tcrlaf (Well, it is what the Sheeple voted for....)
[ Post Reply | Private Reply | To 17 | View Replies]

To: Sacajaweau

Nobody’s buying any Moscow spin on this any more.

Without the heavily Russian Crimea, an antagonized Western and Central Ukraine will easily go anti-Russian next election. Eastern Ukraine will probably be suffer paid Kremlin agitprop until they start breaking away.


24 posted on 04/13/2014 9:25:42 AM PDT by Bogey78O (We had a good run. Coulda been great still.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: tcrlaf
What I said...

What you said that I said....

Why did you post falsely about what I said?

25 posted on 04/13/2014 9:30:43 AM PDT by FreeReign
[ Post Reply | Private Reply | To 23 | View Replies]

To: wetphoenix

All I know is that it has become an axiom that whatever Obama and his gang are for, patriotic Americans should be against.

And we all know who Obama is for in this Ukrain mess.


26 posted on 04/13/2014 10:20:16 AM PDT by Bobalu (Four Cokes And A Fried Chicken)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Bobalu

From RT’s Live Blog:

Events in south-eastern Ukraine have taken a very dangerous turn, the Russian Foreign Ministry said in a statement. Moscow slammed Sunday’s order, issued by the coup-imposed President Aleksandr Turchinov approving a full-scale security operation in the country’s eastern regions, as “criminal”.

“We demand the Maidan henchmen, who overthrew the legitimate president, to immediately stop the war against their own people, to fulfill all the obligations under the Agreement of 21 February,” the Foreign Ministry said.

It depends on the West now to stop the civil war in Ukraine, the ministry stressed.

“The Russian side calls the UN Security Council and the OSCE to urgently consider the crisis in south-east Ukraine,” Moscow concluded.

16:46 GMT:
Over 1, 000 people have gathered in central Slavyansk to protest for the federalization of Ukraine. They demand holding a referendum and to stop pressure on Donbas from Kiev. Protesters are chanting “Glory to Donbas”.

16:36 GMT:
A car with passengers was fired at and two were killed and one injured, said journalist Maxim Levin as cited by Interfax. An unconfirmed report suggests that a press card was found in the car. The injured person is in a serious condition and needs to be transported to Donetsk, Levin added.

16:35 GMT:
One man has been killed in Slavyansk near the hospital, medical officials told RIA Novosti. The man has not yet been identified. There have been unconfirmed reports in Ukrainian media that the man could be a journalist.


27 posted on 04/13/2014 10:27:28 AM PDT by tcrlaf (Well, it is what the Sheeple voted for....)
[ Post Reply | Private Reply | To 26 | View Replies]

To: FreeReign

What a dingbat


28 posted on 04/13/2014 10:32:26 AM PDT by fabian (" And a new day will dawn for those who stand long, and the forests will echo in laughter")
[ Post Reply | Private Reply | To 18 | View Replies]

To: tcrlaf
the coup-imposed President Aleksandr Turchinov

At least someone has history correct.

29 posted on 04/13/2014 10:44:11 AM PDT by McGruff (I wouldn't be surprised if Jeb Bush pulled a Charlie Crist)
[ Post Reply | Private Reply | To 27 | View Replies]

To: wetphoenix

These https://www.youtube.com/watch?feature=youtu.be&v=df92b3Aozog are not locals. This means that Russia technically has invaded another country


30 posted on 04/13/2014 12:20:51 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: goldstategop
It's a major step backwards

What's pathetic is that if the thugs in Kiev had just let an election happen without doing anything dumb, they probably would've won. Why? Crimea's pro-Russian population wouldn't be voting in that election.

They've been a bunch of idiots since the first day or so when they banned Russian as an official language.

31 posted on 04/13/2014 12:30:09 PM PDT by grania
[ Post Reply | Private Reply | To 20 | View Replies]

To: FreeReign; wetphoenix

It appears he does:

http://awesomescreenshot.com/0642nbmq4a


32 posted on 04/13/2014 2:17:22 PM PDT by icwhatudo (Low taxes and less spending in Sodom and Gomorrah is not my idea of a conservative victory)
[ Post Reply | Private Reply | To 22 | View Replies]

To: icwhatudo
You have pictures of Ukraine "sending in" tanks and artillery being used against the invaders and the occupiers?
33 posted on 04/13/2014 2:49:21 PM PDT by FreeReign
[ Post Reply | Private Reply | To 32 | View Replies]

To: icwhatudo
So if an ELECTED Ukrainian government killing people who built barricades, took over buildings, and worked to overthrow the government was bad... How come now an UNELECTED Ukrainian government killing people who build barricades, take over buildings, and work to overthrow the government is ok? Both sides suck in this conflict, but the hypocrisy of some people is really amazing.

You are hopelessly uninformed. There is no popular support for uniting with Russia in Eastern Ukraine. 65 percent are opposed to Russia's aggression, even in the East. These "protestors" are pre-invasion forces sent from Russia with around 500 to 600 extremists recruited from across the country. Russia is invading Ukraine.

34 posted on 04/13/2014 3:06:57 PM PDT by Greetings_Puny_Humans (I mostly come out at night... mostly.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: icwhatudo; Greetings_Puny_Humans

There would have been an election, but there would not have been a legitimate election, in May, with Yanukovych firmly in control. This was widely understood in most of Ukraine.

Parliament took over when Yanukovych & cronies fled. Parliament Speaker Oleksandr Turchynov was voted as interim President by the ELECTED Parliament. Who was unelected?

Note these sections (excerpts) from the statement by Yanukovych own “Party of Regions” (approx. Feb. 23):

“Now Ukraine is living through one of the most difficult and tragic periods in its history,” the faction said in a statement. “The country finds itself deceived and robbed, but even this is nothing in comparison with the grief that dozens of Ukrainian families, who have lost their relatives, are feeling. Ukraine has been betrayed. Viktor Yanukovych and his team are responsible for this.”

“We, the Party of Regions of the Verkhovna Rada of Ukraine and our party members, strongly condemn the criminal orders that led to human losses, to the depletion of the state treasury and the drastic debt increase that shamed the government in the eyes of Ukrainians and the rest of the world. As a result, our country found itself on the edge of a precipice, faced the threat of break-up and loss of national sovereignty. The president failed to heed our advise when it was given to him,” the Party of Regions says.

“We condemn the cowardly flight of Viktor Yanukovych. We condemn the betrayal on his part. We condemn the criminal orders, which exposed common people, soldiers and officers to certain risks”

If anything was unelected, it was Yanukovych massive gathering of power and money to himself.

Read more: http://voiceofrussia.com/news/2014_02_23/Party-of-Regions-faction-blames-Yanukovych-for-fatalities-in-Ukraine-events-5981/


35 posted on 04/13/2014 5:03:09 PM PDT by Paul R. (Leftists desire to control everything; In the end they invariably control nothing worth a damn.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: AdmSmith

It’s pretty clear just by observing it that this “operation” by Putin has been planned and organized for at least a year, if not more.


36 posted on 04/13/2014 5:06:13 PM PDT by Paul R. (Leftists desire to control everything; In the end they invariably control nothing worth a damn.)
[ Post Reply | Private Reply | To 30 | View Replies]

To: Greetings_Puny_Humans

I’m sure some areas in the cities in the East are heavily pro-Russian, but you are correct - there is NO data to support the idea that the entire eastern 3rd of Ukraine wants to secede & join Russia.

It’d be VERY interesting to see results on the equivalent of a precinct by precinct breakdown of where the strongest pro-Russian support is. (Forget ethnicity: Go by population density, economic status, crime rates, and so on — everything we would use to determine a blighted city area here.)

I’d be willing to bet the support for joining Russia comes primarily from exactly the same sort of neighborhoods that vote heavily Dem here. One difference though: I’ve seen nothing to indicate that the majority of the intellectual community in Eastern Ukraine wants to join Russia.


37 posted on 04/13/2014 5:21:12 PM PDT by Paul R. (Leftists desire to control everything; In the end they invariably control nothing worth a damn.)
[ Post Reply | Private Reply | To 34 | View Replies]

To: icwhatudo

um.... because these seperatists are threatening the territorial integrity of Ukraine, are backed by a imperialist Russia, and are threatening violence against those who don’t support them. Completely unlike the Kiev protestors.


38 posted on 04/13/2014 7:49:07 PM PDT by FutureRocketMan (Santorum/Perry or Perry/Santorum 2016 Rand Paul's pretty good too.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: Bobalu

actually, im not sure... granted i haven’t listened to anything Obumhole has said recently.


39 posted on 04/13/2014 7:51:59 PM PDT by FutureRocketMan (Santorum/Perry or Perry/Santorum 2016 Rand Paul's pretty good too.)
[ Post Reply | Private Reply | To 26 | View Replies]

To: Greetings_Puny_Humans
Some of the pre-invasion forces? Nope, no support at all.


40 posted on 04/13/2014 8:03:53 PM PDT by icwhatudo (Low taxes and less spending in Sodom and Gomorrah is not my idea of a conservative victory)
[ Post Reply | Private Reply | To 34 | View Replies]

To: FutureRocketMan
"threatening violence against those who don’t support them. Completely unlike the Kiev protestors."

Wow. Really? I mean, there's a lot of things that can be argued but...seriously?

41 posted on 04/13/2014 8:05:41 PM PDT by icwhatudo (Low taxes and less spending in Sodom and Gomorrah is not my idea of a conservative victory)
[ Post Reply | Private Reply | To 38 | View Replies]

To: icwhatudo
"Some of the pre-invasion forces? Nope, no support at all."

I didn't say there was absolutely no support, or that the Russians can't pay enough people to come out and stand in a crowd. I said that 65 percent of the population did not support it, as confirmed by multiple polls conducted this month and in March, and also in the past. The few hundred extremists marched out by the armed goons choking and punching people (how come you don't post those pictures?), or the Russian Spetsnaz troops (the guys in green, some of whom have been identified) does not justify Russian invasion and annexation.

42 posted on 04/13/2014 8:09:25 PM PDT by Greetings_Puny_Humans (I mostly come out at night... mostly.)
[ Post Reply | Private Reply | To 40 | View Replies]

To: Bluestocking

The Ukraine should demand a new referendum in the Crimea scheduled four years from now, and with international observers. Why have only one? The Russian government will make themselves even more unpopular in the Crimea with their world-class bureaucratic incompetence.

They should also send agents to Kaliningrad and agitate for a referendum there. Kaliningrad would be happy to vote to join Germany but they would probably even vote to join Ukraine if that was the only way to get out from under Moscow.


43 posted on 04/13/2014 8:21:50 PM PDT by Monterrosa-24 (...even more American than a French bikini and a Russian AK-47.)
[ Post Reply | Private Reply | To 21 | View Replies]

To: Monterrosa-24

Haha - I was reading some days back that the Russkis have told the Crimeans “once “in”, you can’t leave.”


44 posted on 04/13/2014 8:29:50 PM PDT by Paul R. (Leftists desire to control everything; In the end they invariably control nothing worth a damn.)
[ Post Reply | Private Reply | To 43 | View Replies]

To: Paul R.

The Hotel Russia - You can check out anytime you like, but you can never leave.


45 posted on 04/13/2014 8:31:55 PM PDT by dfwgator
[ Post Reply | Private Reply | To 44 | View Replies]

To: Paul R.

They also told many people they could not vote in the joke of a referendum they conducted.


46 posted on 04/13/2014 8:34:31 PM PDT by Monterrosa-24 (...even more American than a French bikini and a Russian AK-47.)
[ Post Reply | Private Reply | To 44 | View Replies]

To: Greetings_Puny_Humans
The Western media has abetted the lie that Putin is some sort of macho guy instead of a weaselly little spook with short-man complex. At the same time the Western sports media has largely ignored one of the biggest stories in the entire history of sports with two brothers dominating the heavyweight division. Both of which are at least Gene Tunney's equal in literacy which makes the story even bigger. The Ukraine is justifiably proud of them.  photo wladimir-klitschko_zps316d19ed.jpg Vitali Klitschko photo Vitali-Klitschko_zps2c1e611f.jpg
47 posted on 04/13/2014 8:46:26 PM PDT by Monterrosa-24 (...even more American than a French bikini and a Russian AK-47.)
[ Post Reply | Private Reply | To 42 | View Replies]

To: Greetings_Puny_Humans
"There is no popular support for uniting with Russia in Eastern Ukraine. "

"I didn't say there was absolutely no support"

My mistake.

Obviously Russia is involved in whats happening in the east. Do you think the EU had no involvement with what happened in the west?

48 posted on 04/13/2014 8:50:32 PM PDT by icwhatudo (Low taxes and less spending in Sodom and Gomorrah is not my idea of a conservative victory)
[ Post Reply | Private Reply | To 42 | View Replies]

To: icwhatudo
Call a spade a spade.

As long as the demented Russian goons (who mean us ill by the way)stick to their traditional breeding grounds, no harm no foul.

What is yanking our chain is the development of their tactics, and their attempt to expand.

Looks like CIA is going to piss in Putins cornflakes, and the communist in the WH can't stop them.

49 posted on 04/13/2014 8:56:19 PM PDT by Rome2000
[ Post Reply | Private Reply | To 40 | View Replies]

To: icwhatudo

I’m not sure i follow. Why do you have a problem with that statement. As far as i am aware, there wasn’t much, if any violence perpetrated by Kiev protestors against the Yanukovych regime. Am i wrong?


50 posted on 04/13/2014 9:12:03 PM PDT by FutureRocketMan (Santorum/Perry or Perry/Santorum 2016 Rand Paul's pretty good too.)
[ Post Reply | Private Reply | To 41 | View Replies]


Navigation: use the links below to view more comments.
first 1-5051-59 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson