Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Kremlin Planning Major Announcement, Stage Being Constructed in Red Square
The Pundit Press ^ | 3/13/2015 | Thomas

Posted on 03/13/2015 6:16:35 PM PDT by therightliveswithus

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 61-8081-100101-120 ... 201-217 next last
To: mountn man

nom nom nom,,,


81 posted on 03/13/2015 10:16:14 PM PDT by DesertRhino (I was standing with a rifle, waiting for soviet paratroopers, but communists just ran for office.)
[ Post Reply | Private Reply | To 66 | View Replies]

To: FreeReign

Earlier tweets said it was coming down early due to the warmer weather.


82 posted on 03/13/2015 10:19:10 PM PDT by tcrlaf (They told me it could never happen in America. And then it did....)
[ Post Reply | Private Reply | To 79 | View Replies]

To: laplata
I haven’t seen her but I’m sure she is not ugly or fat.


83 posted on 03/13/2015 10:22:10 PM PDT by cynwoody
[ Post Reply | Private Reply | To 50 | View Replies]

To: cynwoody

Thanks.

Putin had better be nice to her. LOL


84 posted on 03/13/2015 10:26:37 PM PDT by laplata ( Liberals/Progressives have diseased minds.)
[ Post Reply | Private Reply | To 83 | View Replies]

To: therightliveswithus

This is extraordinary.


85 posted on 03/13/2015 10:56:21 PM PDT by Talisker (ne who commands, must obey.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: therightliveswithus
Beware the ides of March, Caesar. “Beware the ides of March,” a soothsayer warned Caesar. Gaius Julius Caesar was assassinated on the ides of March 44 B.C. (March 15 on Julian calendar), a month after Caesar was appointed dictator in perpetuo by the Roman Senate. In Roman times, the ‘ides’ referred to the middle of a month. For the months of March, May, July and October, the ides fell on the 15th day. For the other eight months, the 13th day. The earliest Roman calendar had only 10 months. March (Martius) was the first month of the year. The first full moon of the new year marked the ides of March. This year, a full moon occurred on 05 March 2015, the last day Vladimir Putin was seen publicly. "According to Plutarch, as Caesar arrived at the Senate, Tillius Cimber presented him with a petition to recall his exiled brother. The other conspirators crowded round to offer support. Both Plutarch and Suetonius say that Caesar waved him away, but Cimber grabbed his shoulders and pulled down Caesar's tunic. Caesar then cried to Cimber, 'Why, this is violence!' ('Ista quidem vis est!). At the same time, Casca produced his dagger and made a glancing thrust at the dictator's neck. Caesar turned around quickly and caught Casca by the arm. According to Plutarch, Caesar said in Latin, 'Casca, you villain, what are you doing?' Casca, frightened, shouted, "Help, brother!" in Greek. Within moments, the entire group, including Brutus, was striking out at the dictator. Caesar attempted to get away, but, blinded by blood, he tripped and fell; the men continued stabbing him as he lay defenceless on the lower steps of the portico. According to Eutropius, around 60 or more men participated in the assassination. Caesar was stabbed 23 times."
86 posted on 03/13/2015 11:26:34 PM PDT by concernedcitizen76 (Natural rights of life, liberty, and property are non-negotiable.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv; gandalftb

The announcement of the new imperial regime in Russia:

Major power battle in Kremlin. Putin, Kadyrov, MVD, Sechin vs Ivanov, FSB, Patrushev, Bortnikov, FSO, Naryshkin, Orthodox Church. Serious!

https://twitter.com/anders_aslund/status/576578693923020801


87 posted on 03/13/2015 11:38:36 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13 | View Replies]

To: AdmSmith

Putin may have been replaced by http://en.wikipedia.org/wiki/Sergey_Shoygu It might be civil war.


88 posted on 03/13/2015 11:41:34 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 87 | View Replies]

To: laplata

I was gonna say stacked, but I will concur with your statement.


89 posted on 03/14/2015 12:04:05 AM PDT by LesbianThespianGymnasticMidget (God punishes Conservatives by making them argue with fools.)
[ Post Reply | Private Reply | To 68 | View Replies]

To: doc1019

Obama’s already got dibs on that.


90 posted on 03/14/2015 12:07:38 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 4 | View Replies]

To: elhombrelibre; UMCRevMom@aol.com; SunkenCiv; GeronL; Thunder90; Freelance Warrior; ...

Russia This Week: All the Strange Things Going on in Moscow
http://www.interpretermag.com/russia-this-week-all-the-strange-things-going-on-in-moscow/


91 posted on 03/14/2015 1:15:40 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 88 | View Replies]

To: txhurl

Flags removed from poles....Journalists told not to leave over weekend....

I hear a Coup has occured and would account for the Duma Heads who met in Crimea this week for big meeting....

I have other stuff but not going to post til confirmed...


92 posted on 03/14/2015 1:21:20 AM PDT by caww
[ Post Reply | Private Reply | To 7 | View Replies]

To: caww

Shall we keep a tag on this: http://vk.com/s_shoigu and https://twitter.com/s_shoigu ?


93 posted on 03/14/2015 1:32:50 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 92 | View Replies]

To: tcrlaf
Whatever it is they're going to announce..it comes with a press conference and a whole lot being set up in the square...I think Putin's gone...either by a stroke..or a coup...


94 posted on 03/14/2015 1:34:01 AM PDT by caww
[ Post Reply | Private Reply | To 19 | View Replies]

To: AdmSmith

That’s exactly as I’m hearing....thus far....he’s at the forefront of this shall we say “event”.


95 posted on 03/14/2015 1:36:02 AM PDT by caww
[ Post Reply | Private Reply | To 93 | View Replies]

To: AdmSmith

Nikolai Patrushev and Alexander Bortnikov might be worth a look see as well


96 posted on 03/14/2015 1:37:31 AM PDT by caww
[ Post Reply | Private Reply | To 93 | View Replies]

other stuff going on:

http://rt.com/politics/240461-billionaire-prokhorov-quits-party/

http://finance.yahoo.com/news/russian-lawmaker-kicked-country-speaks-210300907.html


97 posted on 03/14/2015 1:40:48 AM PDT by piasa (Attitude adjustments offered here free of charge)
[ Post Reply | Private Reply | To 92 | View Replies]

To: AdmSmith
Alexei Mukhin,... Director General of the Centre for Political Information confirmed the rumor,... anticipating that “something important” will happen.

When prompted about Putin’s health condition, Mukhin neither confirmed confirmed or denied that Putin is currently “incapacitated.”

Large number of trucks headed into the Kremlin earlier tonight....


98 posted on 03/14/2015 1:41:59 AM PDT by caww
[ Post Reply | Private Reply | To 91 | View Replies]

http://vestnikkavkaza.net/news/politics/67763.html

Russian Foreign Ministry responds to General Scales’ scandalous statement

12 March 2015 - 8:34pm
Spokesman of the Russian Foreign Ministry Alexander Lukashevich, commenting on U.S. General Robert Scales’ call to kill Russians, said that the U.S. was setting the tone for anti-Russian propaganda. He added that Scales’ speech was even more outrageous for appearing on one of the top U.S. TV channels at prime time, TASS reports.

Lukashevich reminded that Russia has initiated a criminal case against General Scales.


99 posted on 03/14/2015 1:43:33 AM PDT by piasa (Attitude adjustments offered here free of charge)
[ Post Reply | Private Reply | To 81 | View Replies]

Russian Bill Would Bar Foreigners From Protests


March 13, 2015

A
Russian ruling-party lawmaker has drafted a bill that would prohibit foreigners from participating in public protests and other demonstrations.

United Russia member Yevgeny Fyodorov said on March 12 that the draft law has been presented to the State Duma, the lower parliament house, for discussions.

Fyodorov said the proposal is aimed “to prevent provocations during mass political rallies and subsequent civil unrest.”

More than 400 people were detained after violence erupted at a protest on the eve of President Vladimir Putin’s inauguration to a third term in May 2012.

Several people have been tried and imprisoned over the violence at the rally on Moscow’s Bolotnaya Square, which the government and protesters blame on one another.

Investigators claimed that the protest was orchestrated by a Georgian politician.

Since then, Russia has tightened regulations for protests and increased punishment for violations, part of what rights activists say is a methodical clampdown on dissent.

Based on reporting by RIA and Moskovsky Komsomolets


100 posted on 03/14/2015 1:45:43 AM PDT by piasa (Attitude adjustments offered here free of charge)
[ Post Reply | Private Reply | To 81 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 61-8081-100101-120 ... 201-217 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson