Free Republic
Browse · Search
News/Activism
Topics · Post Article


1 posted on 07/10/2015 11:59:13 PM PDT by Brad from Tennessee
[ Post Reply | Private Reply | View Replies ]


To: Brad from Tennessee

In that case, liberals will need to start taxing companies for not producing enough CO2.


2 posted on 07/11/2015 12:03:23 AM PDT by Telepathic Intruder (The only thing the Left has learned from the failures of socialism is not to call it that)
[ Post Reply | Private Reply | To 1 | View Replies ]

C’mon, the Sun has no impact on temperature... seriously... go ask a libtard.


3 posted on 07/11/2015 12:10:10 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee
..... I am getting soooooo confused ..... Should we all be stocking up on swim suits .... Or Parkas?

.... Please Al Gore .... Enlighten us ....

4 posted on 07/11/2015 12:22:49 AM PDT by R_Kangel ( "A Nation of Sheep ..... Will Beget ..... a Nation Ruled by Wolves.")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD.. It’s HOT, It’s COLD..

Jeese weather geeks take a chill pill.. <<— metaphor..


5 posted on 07/11/2015 12:30:46 AM PDT by hosepipe (This propaganda has been edited (specifically) to include some fully orbed hyperbole..)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

They can heat St. Peter’s by burning copies of Laudato Si.


6 posted on 07/11/2015 12:46:16 AM PDT by Arthur McGowan
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

Here are a couple of solar tidbits:

What is the rate at which energy is generated in one cubic meter of the core of the Sun?

45 Watts.

How much time elapses from the generation of energy in the center of the Sun to the time it is radiated from the surface?

30,000 years.


7 posted on 07/11/2015 12:58:12 AM PDT by Arthur McGowan
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

It is actually easier to predict solar cycles than the Earth’s climate. BUT, we are assured we are all going to die from global warming and the sun has nothing to do with climate.


8 posted on 07/11/2015 1:21:33 AM PDT by Organic Panic
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

Well if it does, it’ll be because we didn’t pay enough taxes!


9 posted on 07/11/2015 1:36:05 AM PDT by GMMC0987
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee
SUN
10 posted on 07/11/2015 2:28:53 AM PDT by Berlin_Freeper
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee
The Earth could be headed for a 'mini ice age' researchers have warned.

Weren't these dip wads saying this back in the 70s. When it didn't resonate, they changed to global warming. Now, we are back to global cooling again. I wish these A holes would make up their minds once and for all.

11 posted on 07/11/2015 3:12:48 AM PDT by Mark17 (Thy goodness faileth never. Good shepherd may I sing thy praise, within thy house forever. Amen)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee
The Sun's magnetic field is in decline....so less Sunspots...

More data to 2011 here: http://www.dailykos.com/story/2011/07/29/999981/-eSci-The-Sun-is-Acting-Strangely#

12 posted on 07/11/2015 3:53:02 AM PDT by spokeshave
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

At least my energy stocks will come back then.....


13 posted on 07/11/2015 3:56:56 AM PDT by kjam22 (my music video "If My People" at https://www.youtube.com/watch?v=74b20RjILy4)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

Sun going to sleep?

Bill Cosby slipped it some date rape drugs....wasn’t no pudding pop.


14 posted on 07/11/2015 3:57:54 AM PDT by Covenantor ("Men are ruled...by liars who 4refuse them news, and by fools who cannot govern." Chesterton)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

“The Maunder Minimum (also known as the prolonged sunspot minimum) is the name used for the period starting in about 1645 and continuing to about 1715 when sunspots became exceedingly rare, as noted by solar observers of the time.

It caused London’s River Thames to freeze over, and ‘frost fairs’ became popular.”

Never happened...burn those books...


17 posted on 07/11/2015 4:19:00 AM PDT by Crim (Palin / West '16)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

If mankind had any sense we’d go nuclear in a big way - just in case. Even if it’s actually warming we’ll have the power for the AC! ; -)


18 posted on 07/11/2015 4:36:56 AM PDT by Tunehead54 (Nothing funny here ;-)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

After reading the article, I read the responses. Number 2 and 3 - you cracked my up! :>)


25 posted on 07/11/2015 5:19:25 AM PDT by Gumdrop
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee; BillyBoy; sickoflibs; GOPsterinMA; fieldmarshaldj; Clintonfatigued; NFHale; ...

One of my fav “Twilight Zone” Episodes is “The Midnight Sun”.

http://www.dailymotion.com/video/x2ee3q9_science-fiction-treasures-the-midnight-sun-1961-twilight-zone-series-by-rod-serling-epsat_shortfilms

Are we freezing or burning up libs? Make up your minds!!


33 posted on 07/11/2015 6:09:42 PM PDT by Impy (They pull a knife, you pull a gun. That's the CHICAGO WAY, and that's how you beat the rats!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

Zharkova and her colleagues derived their model using a technique called ‘principal component analysis’ of the magnetic field observations from the Wilcox Solar Observatory in California. They examined three solar cycles-worth of magnetic field activity, covering the period from 1976-2008. In addition, they compared their predictions to average sunspot numbers, another strong marker of solar activity. All the predictions and observations were closely matched.

http://www.ras.org.uk/news-and-press/2680-irregular-heartbeat-of-the-sun-driven-by-double-dynamo


37 posted on 07/12/2015 1:07:02 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson