Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: AdmSmith

The Russian government is the number one organized crime unit in Russia.


19 posted on 04/03/2017 7:50:32 PM PDT by ETL (Trump admin apparently playing "good cop, bad cop" with thug Putin (see my FR Home page))
[ Post Reply | Private Reply | To 18 | View Replies ]


To: ETL; The Westerner; lodi90; TigerLikesRooster

The 9 Russian Words That Explain KremlinGate
It’s International Talk Like a Chekist Day—here’s a quick primer on kombinatsiya, konspiratsiya and more
http://observer.com/2017/03/kremlingate-russia-spy-game-disinformation/


20 posted on 04/05/2017 7:04:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson