Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: adorno; alexander_busek; AmericanInTokyo; Apparatchik; ArtDodger; AZJeep; baclava; BeauBo; ...
Russian blogger:

The authorities are preparing a plan to increase the birth rate. One of the ideas is to shorten the gestation period.

Our high-ranking source, speaking on condition of anonymity, told us that the authorities are preparing a plan to increase the birth rate. This should solve the demographic problem that arose in the country long before the SVO. And after the start of the war it got even worse.

The document is still under development, but several key ideas are known.

Firstly, increasing payments for the birth of children. It is no secret that the leaders in birth rates in recent years have been Ingushetia and Dagestan, but the government wants to change the situation in favor of the birth of ethnic Russians. It is proposed to solve the problem by increasing payments to ethnic Russians. In this regard, the opening of such Mother and Child Homes is being discussed, where selected women will become pregnant and give birth to children. But not for himself, but for the state. This project is called “Cuckoo” in closed circles.

Secondly, researchers have been tasked with studying the possibility of giving birth to healthy children not in 9, but conditionally in 8 months. This way, women will be able to give birth more often and faster. If the experiments give a positive result, then they can be scaled up within the framework of the Cuckoo Project.

Thirdly, the government has been tasked with increasing the number of male births in the country. There are no specific proposals yet, but there are rumors that this project is personally supervised by the president's daughter, Maria Vorontsova.[Abortions of female fetuses?]

These are the kind of ideas the government wants. I would like to hear the Church's reaction to such artificial mechanisms for increasing the birth rate of Russians. Our interlocutor emphasized that the result of launching the program will be clear in 5-7 years, but the main thing - the change in the gene pool - should become noticeable in 20-25 years. This should also be affected by restrictions on illegal migrants , which should reduce their number within the country.

https://t.me/kremlin_secrets/4038

We have seen this before in Nazi Germany:

Lebensborn was an SS-initiated, state-supported, registered association in Nazi Germany with the stated goal of increasing the number of children born who met the Nazi standards of “racially pure” and “healthy” Aryans, based on Nazi eugenics (also called “racial hygiene” by some eugenicists). Lebensborn was established by Heinrich Himmler, and provided welfare to its mostly unmarried mothers, encouraged anonymous births by unmarried women at their maternity homes, and mediated adoption of children by likewise “racially pure” and “healthy” parents, particularly SS members and their families.

The Russian tax on childlessnes https://freerepublic.com/focus/news/4042550/posts?page=6285#6285

6,314 posted on 05/05/2024 5:06:53 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6285 | View Replies ]


To: AdmSmith

The monstrosity called Russia must be obliterated.


6,317 posted on 05/05/2024 6:48:12 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6314 | View Replies ]

To: AdmSmith

LOL, what? Russia’s fertility rate is 1.5. I think it’s safe to say shortening gestation won’t affect that at all.


6,321 posted on 05/05/2024 9:26:40 AM PDT by The Pack Knight
[ Post Reply | Private Reply | To 6314 | View Replies ]

To: AdmSmith; Apparatchik; BeauBo; Monterrosa-24; PIF; USA-FRANCE; canuck_conservative; ...

Wow, these Russians have some crazy ideas about how the human body works. The craziest one is the idea of shortenening the gestation period to 8 months. Will this help provide a chimpanzee level of intelligence. Part of the longer gestation is the long time for the human brain to develop. My first son was born 3 weeks post mature at 9 lbs. My second son was born a month early at 7 lbs. All of my first sons developmental stages were MOrE than 2 months ahead of those of my p son. Things like first smile, reaching for objects—things requiring intelligence and eye/muscle coordination.

There are already ways to increase the rate of male fetal production. Not going to say what they are, but I have used them with success. God help the poor Russian women (or captive Ukrainian women) who will be used for some of this experimentation. Putin’s lacky Orthodox church leader might be agreeable, but what about the rest of their priesthood and old believers? Next they will be forcing sterilization on their non ethnic Russian populations.


6,323 posted on 05/05/2024 11:02:45 AM PDT by gleeaikin ( Question authority.)
[ Post Reply | Private Reply | To 6314 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson