Posted on 03/12/2002 11:41:34 AM PST by Physicist
An endangered monkey has given scientists new insights into evolution. The leaf-eating douc langur, native to East and Southeast Asia, has a "duplicated" gene that started as an extra copy of a gene for a particular enzyme but mutated into a gene for another enzyme with a different purpose. By recreating the gene's path from one enzyme to the other, scientists have addressed an important debate over how natural selection shapes such duplications.
Throughout evolutionary history, extra copies of genes have popped up spontaneously in the genomes of many organisms. This gene duplication is thought to be a major source of new genes and adaptations. But scientists disagree about what method natural selection uses to modify the extra copies. Some say positive selection favors duplicated genes that take on a new function. Others credit the lack of negative selection; because the new gene is redundant, it is free to mutate until it finds a new job. But most studies are based on statistical analyses that cannot distinguish definitively between the alternatives.
Now, evolutionary geneticist Jianzhi Zhang of the University of Michigan, Ann Arbor, says both theories are right. He and his colleagues discovered a duplicated gene for an enzyme called ribonuclease in the douc langur. In humans and other primates, ribonuclease attacks double-stranded RNA; it may help defend against viruses, some of which contain such genetic material. But in douc langurs, the duplicate ribonuclease gene evolved into a gene for a digestive enzyme. This enzyme helps supply protein by digesting the single-stranded RNA of leaf-fermenting bacteria that live in the langur's intestine.
To find out how the duplicate evolved, the researchers created nine designer mutant proteins, each with one of the nine amino acid changes that separate the duplicate from the original. Every change reduced the enzyme's ability to degrade double-stranded RNA--the enzyme's original job. This hints at a lack of negative selection. But statistical analysis showed that the duplicate gene evolved much faster than would be expected from random change, suggesting that positive selection was at work too, the team reports in the March 2002 issue of Nature Genetics.
Shozo Yokoyama, an evolutionary biologist at Syracuse University in New York state, says Zhang's functional tests are a difficult and essential step toward understanding the role of duplication. But the final answer is still not there, he says. More research is needed to show not only how the amino acid changes reduced the ribonuclease's old function, but also how they helped it reach its new function.
Physicist nailed it. We only know that the genes differ by nine base pairs. We do not know if either is unevolved since the duplication event.
You are a little behind. Read post 117. I had already surmised that when I asked you if you could solve it in post 100.
Not necessarily. The proteins differ by nine changes.
with one of the nine amino acid changes that separate the duplicate from the original
Is that Vade's Razor?
(See how easy that is?)
I wouldn't know. I got it right the first time.
That's BS. In order to have a meaningful dialectic between evolution and religion, you would need a religion which operated on an intellectual level similar to that of evolution, and the only two possible candidates would be Rastifari and Voodoo. The debate would be between the evolutionists, and the voodoo doctors: Dick Dawkins vs Jr. Doc Duvalier.
The real dialectic is between evolution and mathematics. Professing belief in evolution at this juncture amounts to the same thing as claiming not to believe in modern mathematics, probability theory, and logic. It's basically ignorant.
Evolution has been so thoroughly discredited at this point that you assume nobody is defending it because they believe in it anymore, and that they are defending it because they do not like the prospects of having to defend or explain some expect of their lifestyles to God, St. Peter, Muhammed...
To these people I say, you've still got a problem. The problem is that evolution, as a doctrine, is so overwhelmingly STUPID that, faced with a choice of wearing a sweatshirt with a scarlet letter A for Adulteror, F for Fornicator or some such traditional design, or or a big scarlet letter I for IDIOT, you'd actually be better off sticking with one of the traditional choices because, as Clint Eastwood noted in The Good, The Bad, and The Ugly:
God hates IDIOTS, too!
The best illustration of how stupid evolutionism really is involves trying to become some totally new animal with new organs, a new basic plan for existence, and new requirements for integration between both old and new organs.
Take flying birds for example; suppose you aren't one, and you want to become one. You'll need a baker's dozen highly specialized systems, including wings, flight feathers, a specialized light bone structure, specialized flow-through design heart and lungs, specialized tail, specialized general balance parameters etc.
For starters, every one of these things would be antifunctional until the day on which the whole thing came together, so that the chances of evolving any of these things by any process resembling evolution (mutations plus selection) would amount to an infinitessimal, i.e. one divided by some gigantic number.
In probability theory, to compute the probability of two things happening at once, you multiply the probabilities together. That says that the likelihood of all these things ever happening, best case, is ten or twelve such infinitessimals multiplied together, i.e. a tenth or twelth-order infinitessimal. The whole history of the universe isn't long enough for that to happen once.
All of that was the best case. In real life, it's even worse than that. In real life, natural selection could not plausibly select for hoped-for functionality, which is what would be required in order to evolve flight feathers on something which could not fly apriori. In real life, all you'd ever get would some sort of a random walk around some starting point, rather than the unidircetional march towards a future requirement which evolution requires.
And the real killer, i.e. the thing which simply kills evolutionism dead, is the following consideration: In real life, assuming you were to somehow miraculously evolve the first feature you'd need to become a flying bird, then by the time another 10,000 generations rolled around and you evolved the second such reature, the first, having been disfunctional/antifunctional all the while, would have DE-EVOLVED and either disappeared altogether or become vestigial.
Now, it would be miraculous if, given all the above, some new kind of complex creature with new organs and a new basic plan for life had ever evolved ONCE.
Evolutionism, however (the Theory of Evolution) requires that this has happened countless billions of times, i.e. an essentially infinite number of absolutely zero probability events.
And, if you were starting to think that nothing could possibly be any stupider than believing in evolution despite all of the above (i.e. that the basic stupidity of evolutionism starting from 1980 or thereabouts could not possibly be improved upon), think again. Because there is zero evidence in the fossil record (despite the BS claims of talk.origins "crew" and others of their ilk) to support any sort of a theory involving macroevolution, and because the original conceptions of evolution are flatly refuted by developments in population genetics since the 1950's, the latest incarnation of this theory, Steve Gould and Niles Eldredge's "Punctuated Equilibrium or punc-eek" attempts to claim that these wholesale violations of probabilistic laws all occurred so suddenly as to never leave evidence in the fossil record, and that they all occurred amongst tiny groups of animals living in "peripheral" areas. That says that some velocirapter who wanted to be a bird got together with fifty of his friends and said:
Guys, we need flight feathers, and wings, and specialized bones, hearts, lungs, and tails, and we need em NOW; not two years from now. Everybody ready, all together now: OOOOOMMMMMMMMMMMMMmmmmmmmmmmmmmmmmmmmmmmmmmmmmm.....
You could devise a new religion by taking the single stupidest doctrine from each of the existing religions, and it would not be as stupid as THAT.
But it gets even stupider.
Again, the original Darwinian vision of gradualistic evolution is flatly refuted by the fossil record (Darwinian evolution demanded that the vast bulk of ALL fossils be intermediates) and by the findings of population genetics, particularly the Haldane dilemma and the impossible time requirements for spreading genetic changes through any sizeable herd of animals.
Consider what Gould and other punk-eekers are saying. Punc-eek amounts to a claim that all meaningful evolutionary change takes place in peripheral areas, amongst tiny groups of animals which develop some genetic advantage, and then move out and overwhelm, outcompete, and replace the larger herds. They are claiming that this eliminates the need to spread genetic change through any sizeable herd of animals and, at the same time, is why we never find intermediate fossils (since there are never enough of these CHANGELINGS to leave fossil evidence).
Obvious problems with punctuated equilibria include, minimally:
1. It is a pure pseudoscience seeking to explain and actually be proved by a lack of evidence rather than by evidence (all the missing intermediate fossils). Similarly, Cotton Mather claimed that the fact that nobody had ever seen or heard a witch was proof they were there (if you could see or hear them, they wouldn't be witches...) That sort of logic is less limiting than the ordinary logic which used to be taught in American schools. For instance, I could claim that the fact that the fact that nobody has ever seen me with Tina Turner was all the evidence anybody could want that I was sleeping with her.....2. PE amounts to a claim that inbreeding is the most major source of genetic advancement in the world. Apparently Steve Gould never saw Deliverance...
3. PE requires these tiny peripheral groups to conquer vastly larger groups of animals millions if not billions of times, which is like requiring Custer to win at the little Big Horn every day, for millions of years.
4. PE requires an eternal victory of animals specifically adapted to localized and parochial conditions over animals which are globally adapted, which never happens in real life.
5. For any number of reasons, you need a minimal population of any animal to be viable. This is before the tiny group even gets started in overwhelming the vast herds. A number of American species such as the heath hen became non-viable when their numbers were reduced to a few thousand; at that point, any stroke of bad luck at all, a hard winter, a skewed sex ratio in one generation, a disease of some sort, and it's all over. The heath hen was fine as long as it was spread out over the East coast of the U.S. The point at which it got penned into one of these "peripheral" areas which Gould and Eldredge see as the salvation for evolutionism, it was all over.
The sort of things noted in items 3 and 5 are generally referred to as the "gambler's problem", in this case, the problem facing the tiny group of "peripheral" animals being similar to that facing a gambler trying to beat the house in blackjack or roulette; the house could lose many hands of cards or rolls of the dice without flinching, and the globally-adapted species spread out over a continent could withstand just about anything short of a continental-scale catastrophe without going extinct, while two or three bad rolls of the dice will bankrupt the gambler, and any combination of two or three strokes of bad luck will wipe out the "peripheral" species. Gould's basic method of handling this problem is to ignore it.
And there's one other thing which should be obvious to anybody attempting to read through Gould and Eldridge's BS:
They are claiming that at certain times, amongst tiny groups of animals living in peripheral areas, a "speciation event(TM)" happens, and THEN the rest of it takes place. In other words, they are saying:
ASSUMING that Abracadabra-Shazaam(TM) happens, then the rest of the business proceeds as we have described in our scholarly discourse above!
Again, Gould and Eldridge require that the Abracadabra-Shazaam(TM) happen not just once, but countless billions of times, i.e. at least once for every kind of complex creature which has ever walked the Earth. They do not specify whether this amounts to the same Abracadabra-Shazaam each time, or a different kind of Abracadabra-Shazaam for each creature.
I ask you: How could anything be stupider or worse than that? What could possibly be worse than professing to believe in such a thing?
Many Experts Quoted on FUBAR State of Evolution
"If a person doesn't think that there is a God to be accountable to, then what's the point of trying to modify your behavior to keep it within acceptable ranges? That's how I thought anyway. I always believed the theory of evolution as truth, that we all came from slime. When we died, you know , that was it, there is nothing..."
Jeffrey Dahmer, noted Evolutionist
AndrewC: Is that Vade's Razor?
Whatever. I'm not on this forum to prove my encyclopedic knowledge, which owes a lot to Yahoo! anyway, or my incisive reasoning. Mostly, at any given time, I'm just explaining why I think what I think.
That's why it doesn't matter if I make a mistake, or if I don't see something right away, or whatever. My typing amounts to thinking out loud.
You had yet another for your list of Problems of Darwinism when you thought all the mutations were on the new gene. I would not have been impressed even if we could establish that as fact, but we have no such information.
We only know that the expressed proteins are different by nine amino acids. Both genes might have been shot to heck with harmless, neutral mutations, or maybe only the minimum to get the difference we see.
For all we know.
Believing that:
1) Velikovsky was right,
2) The dinosaurs could be big because Saturn was floating in the sky overhead, lessening felt gravity,
3) Light is really instantaneous although science thinks it goes at 300,000 km/sec in a vacuum,
4) Elements may be swiftly transmuted in something that looks like a microwave oven,
5) Indian rock art shows that dinosaurs were still around after crayolas were invented.
Did I forget any?
I don't care if I guess it in time, it's still not a problem.Is that Vade's Razor?
Not really; the Reepo razor goes like this, more or less:
What about it, Reep? Isn't that the basic rhetorical methodology?
Yes and I pointed out a possible way to clarify the situation. The text itself says that other animals have the protein. It is then quite simple to find the basal possibilities. That is called science. Using something like the following
| 11 471 human-ECP ATGGTTCCAAAACTGTTCACTTCCCAAATTTGTCTGCTTCTTCTGTTGGGGCTTATGGGTGTGGAGGGCTCACTCCATGCCAGACCCCCACAGTTTACGAGGGCTCAGTGGTTTGCCATCCAGCACATCAGTCTGAACCCCCCTCGATGCACCATTGCAATGCGGGCAATTAACAATTATCGATGGCGTTGCAAAAACCAAAATACTTTTCTTCGTACAACTTTTGCTAATGTAGTTAATGTTTGTGGTAACCAAAGTATACGCTGCCCTCATAACAGAACTCTCAACAATTGTCATCGGAGTAGATTCCGGGTGCCTTTACTCCACTGTGACCTCATAGGTGCACAGATTTCAAACTGCAGGTATGCAGACAGACCAGGAAGGAGGTTCTATGTAGTTGCATGTGACAACAGAGATCCACGGGATTCTCCACGGTATCCTGTGGTTCCAGTTCACCTGGATACCACCATC chimp-ECP ATGGTTCCAAAACTGTTCACTTCCCAAATTTGTCTGCTTCTTCTGTTGGGGCTTATGGGTGTGGAGGGCTCACTCCATGCCAGACCCCCACAGTTTACGAGGGCTCAGTGGTTTGCCATCCAGCACATCAGTCTGAACCCCCCTCGATGCACCATTGCAATGCGGGTAATTAACAATTATCGATGGCGTTGCAAAAACCAAAATACTTTTCTTCGTACAACTTTTGCTAATGTAGTTAATGTTTGTGGTAACCAAAGTATACGCTGCCCTCATAACAGAACCCTCAACAATTGTCATCAGAGTAGATTCCGGGTGCCTTTACTCCACTGTGACCTCATAGGTGCACAGATTTCAAACTGCGGGTATGCAGACAGACCAGGAAGGAGGTTCTATGTAGTTGCATGTGACAACAGAGATCCACGGGATTCTCCACGGTATCCTGTGGTTCCAGTTCACCTGGATACCACCATC gorilla-ECP ATGGTTCCAAAACTGTTCACTTCCCAAATTTGTCTGCTTCTTCTGTTGGGGCTTATGGGTGTGGAGGGCTCACTCCATGCCAGACCCCCACAGTTTACGAGGGCTCAGTGGTTTGCCATCCAGCACATCAGTCTGAACCCCCCTCGATGCACCATTGCAATGCGGGTAATTAACAATTATCGATGGCGTTGCAAAAACCAAAATACTTTTCTTCGTACAACTTTTGCTAATGTAGTTAATGTTTGTGGTAACCAAAGTATACGCTGCCTTCATAACAGAACTCTCAACAATTGTCATCGGAGTAGATTCCGGGTGCCTTTACTCCACTGTGACCTCATAGGTGCACAGATTTCAAACTGCAGGTATGCAGACAGACCAGGAAGGAGGTTCTATGTAGTTGCATGTGACAACAGAGATCCACAGGATTCTCCACGGTATCCTGTGGTTCCTGTTCACCTGGATACCACCATC orangutan-ECP ATGGTTCCAAAACTGTTCACTTCCCAAATTTGTCTGCTTCTTCTGTTGGGGCTTAGTGGTGTGGGGGGCTCACTCCATGCCAAACCCCGACAGTTTACGAGGGCTCAGTGGTTTGCCATCCAGCACGTCAGTCTGAACCCTCCTCAATGCACCACTGCAATGCGGGTAATTAACAATTATCAACGGCGTTGCAAAGACCAAAATACTTTTCTTCGTACAACTTTTGCTAATGTAGTTAATGTTTGTGGTAACCCAAATATAACCTGTCCTCGTAACAGAACTCTCCACAATTGTCATCGGAGTAGATTCCAGGTGCCTTTACTCCACTGTAACCTCACAGGTGCACAGATTTCAAACTGCAAGTATGCAGACAGAACAGAAAGGAGGTTCTATGTAGTTGCATGTGACAACAGAGATCCACGGGATTCTCCACGGTATCCTGTGGTTCCAGTTCACCTGGATACCACCATC macaque-ECP ATGGTTCCAAAACTGTTCACTTCCCAAATTTGTCTGCTTCTTCTGTTGGGGCTTATGGGTGTGGAGGGCTCACTCCATGCCAGACCCCCACAGTTTACAAAGGCTCAGTGGTTTGCCATCCAGCACATCAATGTGAACCCCCCTCGATGCACCATTGCAATGCGGGTAATAAATAATTATCAACGGCGTTGCAAAAACCAAAATACTTTTCTTCGTACAACTTTTGCATATACAGCTAATGTTTGTCGTAACGAACGTATACGCTGCCCTCGTAACAGAACTCTCCACAATTGTCATCGTAGTAGATACCGGGTGCCTTTACTCCACTGTGACCTCATAGGTGCACAGATTTCAACCTGCAGGTATGCAGACAGACCAGGACGGAGGTTCTATGTAGTTGCATGTGAAAGCAGAGATCCACGGGATTCTCCACGGTATCCAGTGGTTCCAGTTCACCTGGATACCACCATC human-EDN ATGGTTCCAAAACTGTTCACTTCCCAAATTTGTCTGCTTCTTCTGTTGGGGCTTCTGGCTGTGGAGGGCTCACTCCATGTCAAACCTCCACAGTTTACCTGGGCTCAATGGTTTGAAACCCAGCACATCAATATGACCTCCCAGCAATGCACCAATGCAATGCAGGTCATTAACAATTATCAACGGCGATGCAAAAACCAAAATACTTTCCTTCTTACAACTTTTGCTAACGTAGTTAATGTTTGTGGTAACCCAAATATGACCTGTCCTAGTAACAAAACTCGCAAAAATTGTCACCACAGTGGAAGCCAGGTGCCTTTAATCCACTGTAACCTCACAAGTCCACAGATTTCAAACTGCAGGTATGCGCAGACACCAGCAAACATGTTCTATATAGTTGCATGTGACAACAGAGATCAACGAGACCCTCCACAGTATCCGGTGGTTCCAGTTCACCTGGATAGAATCATC chimp-EDN ATGGTTCCAAAACTGTTCACTTCCCAAATTTGTCTGCTTCTTCTGTTGGGGCTTCTGGCTGTGGAGGGCTCACTCCATGTCAAACCTCCACAGTTTACCTGGGCTCAATGGTTTGAAACCCAGCACATCAATATGACATCCCAGCAATGCACCAATGCAATGCAGGTCATTAACAATTATCAACGGCGATGCAAAAACCAAAATACTTTCCTTCTTACAACTTTTGCTAACGTAGTTAATGTTTGTGGTAACCCAAATATGACCTGTCCTAGTAACAAAACTCGCAAAAATTGTCATCAAAGTGGAAGCCAGGTGCCTTTAATCCACTGTAACCTCACAAGTCCACAGATTTCAAACTGCAGGTATGCGCAGACACCAGCAAACATGTTCTATATAGTTGCATGTGACAACAGAGATCAACGGGACCCTCCACAGTATCCGGTGGTTCCAGTTCACCTGGATAGAATCATC gorilla-EDN ATGGTTCCAAAACTGTTCACTTCCCAAATTTGTCTGCTTCTTCTGTTGGGGCTTCTGGCAGTGGAGGGCTCACTCCATGTCAAACCTCCACAGTTTACCTGGGCTCAATGGTTTGAAACCCAGCACATCAATATGACCTCCCAGCAATGCACCAATGCAATGCGGGTCATTAACAATTATCAACGGCGATGCAAAAACCAAAATACTTTCCTTCTTACAACTTTTGCTAACGTAGTTAATGTTTGTGGTAACCCAAATATGACCTGTCCTAGTAACAAAACTCGCAAAAATTGTCATCACAGTGGAAGCCAGGTGCCTTTAATCCACTGTAACCTCACAAGTCCACAGATTTCAAACTGCAGGTATGCGCAGACACCAGCAAACATGTTCTATATAGTTGCATGTGACAACAGAGATCAACGGGACCCTCCACAGTATCCAGTGGTTCCAGTTCACCTGGATAGAATCATC organgutan-EDN ATGGTTCCAAAACTGTTCACTTCTCAAATTTCCCTGCTTCTTCTGTTGGGGCTTCTGGCTGTGGACGGCTCACTCCATGTCAAACCTCCACAGTTTACCTGGGCTCAATGGTTTGAAACCCAGCACATCAATATGACCTCCCAGCAATGCAACAATGCAATGCAGGTCATTAACAATTTTCAACGGCGTTGCAAAAACCAAAATACTTTTCTGCGTACAACTTTTGCTAATGTAGTTAATGTTTGTGGTAACCCAAATATAACCTGTCCTAGTAACAGAAGTCGCAACAATTGTCATCATAGTGGAGTCCAGGTGCCTTTAATCCACTGTAACCTCACAAGTCCACAGATTTCAAACTGCAGGTATGCGCAGACACCAGCAAACATGTTCTATATAGTTGCATGTGACAACAGGGATCCACGGGACCCTCCACAGTATCCGGTGGTTCCAGTTCACCTGGATAGAATCATC macaque-EDN ATGGTTCCAAAACTGTTCACTTCCCAAATTTGTCTGCTTCTTCTGTTGGGGCTTATGGGTGTGGAAGGCTCACTTCATGCCAAACCCGGACAATTTACCTGGGCTCAGTGGTTTGAAATCCAGCATATAAATATGACCTCTGGCCAATGCACCAATGCAATGCAGGTCATTAACAATTATCAACGGCGATGCAAAAATCAAAATACTTTTCTTCTTACAACTTTTGCTGATGTAGTTCATGTCTGTGGTAACCCAAGCATGCCCTGCCCTAGCAACACAAGTCTCAACAATTGTCATCATAGTGGAGTCCAGGTGCCTTTAATCCACTGTAACCTCACAAGTCGAAGGATTTCAAATTGCAGGTATACACAGACAACAGCAAACAAGTACTACATAGTTGCATGTAACAACAGCGATCCACGGGACCCTCCACAGTATCCAGTGGTTCCAGTTCACCTGGATAGAATCATC tamarin-EDN ATGGTTCCAAAACTGTTCACTTCCCAAATTTGCGTGCTTCTTCTTTTCGGGCTTTTGAGTGTGGAGGTCTCACTCCAGGTCAAACCCCAGCAGTTTTCCTGGGCTCAGTGGTTTAGCATCCAGCACATCCAAACAACTCCCCTCCACTGCACCTCTGCAATGCGGGCAATTAACAGGTATCAACCTCGATGCAAAAACCAAAATACTTTTCTTCATACAACTTTTGCTAATGTAGTTAATGTTTGTGGTAACACAAATATCACCTGCCCTCGTAATGCATCTCTCAACAATTGTCATCACAGTGGAGTCCAGGTGCCTTTAACCTACTGTAACCTCACAGGTCCACAGATTTCAAACTGTGTGTATTCCTCGACTCAGGCAAACATGTTCTATGTAGTTGCATGTGACAACAGAGATCCACGGGATCCTCCACAGTATCCAGTGGTCCCGGTTCACCTGGATACCACCATC (((((1,2),3),4),5),((((6,7),8),9),10),11) |
(You never got back to me on who was faking what data re Venus. I don't see how you can claim to have the evidence behind you while simultaneously resorting to this.)
Darwinism has the floor.
I'm just trying to keep it that way.
Then what is your worry?
A little. I am reminded via Freepmail that I forgot the psychic parrot.
Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.