Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Scholars say Philistine genes help solve biblical mystery
www.wpri.com ^ | Posted: Jul 3, 2019 / 02:13 PM EDT / Updated: Jul 3, 2019 / 02:21 PM EDT | by: ILAN BEN ZION

Posted on 07/03/2019 1:16:54 PM PDT by Red Badger

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-80 ... 101-111 next last
To: Vigilanteman

“Interesting stuff. The more separate peoples stay together in one location, the more blended their genetic DNA becomes The Spanish were in the Americas a mere century longer than the English (fall of Mexico City, 1521— landing at Plymouth Rock, 1620) but their DNA is far more blended with Native and African DNA than descendants of their counterparts of primarily English ancestry . . . in a mere century, less than 1.7% of recorded human history.”

One of my semi white UK/Scot/Wales/Western Europe DNA snowflake relatives described “ what you noted as: “The Spaniards were hornier and most often came over here without wives. So they $crewed a lot more natives and left more mixed blood offspring. Than their white counterparts.

Those horney guys versus the sexually uptight white protestant guys often with a wife and children left wide trails of DNA.

The white couple might have had 20 plus children, but the descendants often had the same white DNA and father and mother.

This same previously unknown DNA relative and I had heard for years of having Cherokee ancestors. Between the two of us we have close to 200 identified on paper Indian relatives and yet zero Indian DNA.

We both also have about 3% African DNA from the same African area.

Yet we can’t find a single African ancestor in just under 50,000 ancestors between the two of us.

The Spaniards and mixed bloods from the Caribbean as you noted had been actively breeding in America since the late 1490’s. As a result, possibly no true Native American Tribes existed in our SE part of what is now America


41 posted on 07/03/2019 2:59:30 PM PDT by Grampa Dave (KAG! Keep America Great! Vote for President Trump in 2020! KAG! Keep America Great, Again!)
[ Post Reply | Private Reply | To 17 | View Replies]

To: Red Badger; yarddog

That’s one deity they in particular worshipped, but like almost every people at the time, they were polytheists. Dagon was probably “their” god that they brought with them, but they certainly had shrines to Baal, Ishtar, Molech and all the other common local gods as well.


42 posted on 07/03/2019 3:00:05 PM PDT by Boogieman
[ Post Reply | Private Reply | To 19 | View Replies]

To: chajin

“or the Hittites?”

Hittites were definitely a different people, because we have records mentioning the various “sea people” tribes along with the Hittites, because the Hittites both allied with them (to fight Egypt) and then ended up fighting against them when the sea peoples gave up on Egypt and started attacking elsewhere.


43 posted on 07/03/2019 3:03:39 PM PDT by Boogieman
[ Post Reply | Private Reply | To 9 | View Replies]

The name Goliath, like Achish, is not Semitic, but rather Anatolian (McCarter 1980, 291, Mitchell 1967, 415; Wainwright 1959, 79). Not all agree though; the International Standard Bible Encyclopedia (2:524) proposes that Goliath may have been a remnant of one of the aboriginal groups of giants of Palestine who now were in the employ of the Philistines. [1. Naveh (1985, 9, 13 n. 14) states that Ikausu, the name of the king of Ekron in the seventh century b.c., is a non-Semitic name that can be associated with that of the Achish of Gath in David's time. The name in the seventh century has a shin ending that is non-West Semitic.]

David's Flight | Giving Goliath His Due: New Archaeological Light on the Philistines [chapter 5] | by Neal Bierling | foreword by Paul L. Maier
'Civ's note: In Pharaohs and Kings David Rohl suggests (pp 164, 168, and 224) that the king of Gath, a Philistine city, had a Hurrian/Carian name, which is not that farfetched, but the idea that King David ruled in Jerusalem at the same time is incorrect. The Gath reference Rohl cites is found in the Amarna diplomatic correspondence, a time in which Gath was no longer Philistine, the Philistines themselves no longer a going concern and David was long dead.

44 posted on 07/03/2019 3:09:45 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | View Replies]

whoops, corrected link:
The name Goliath, like Achish, is not Semitic, but rather Anatolian (McCarter 1980, 291, Mitchell 1967, 415; Wainwright 1959, 79). Not all agree though; the International Standard Bible Encyclopedia (2:524) proposes that Goliath may have been a remnant of one of the aboriginal groups of giants of Palestine who now were in the employ of the Philistines. [1. Naveh (1985, 9, 13 n. 14) states that Ikausu, the name of the king of Ekron in the seventh century b.c., is a non-Semitic name that can be associated with that of the Achish of Gath in David's time. The name in the seventh century has a shin ending that is non-West Semitic.]

David's Flight | Giving Goliath His Due: New Archaeological Light on the Philistines [chapter 5] | by Neal Bierling | foreword by Paul L. Maier
'Civ's note: In Pharaohs and Kings David Rohl suggests (pp 164, 168, and 224) that the king of Gath, a Philistine city, had a Hurrian/Carian name, which is not that farfetched, but the idea that King David ruled in Jerusalem at the same time is incorrect. The Gath reference Rohl cites is found in the Amarna diplomatic correspondence, a time in which Gath was no longer Philistine, the Philistines themselves no longer a going concern and David was long dead.

45 posted on 07/03/2019 3:51:18 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 44 | View Replies]

http://www.freerepublic.com/focus/chat/3045685/posts?page=16#16


46 posted on 07/03/2019 3:53:26 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 44 | View Replies]

To: chajin

The Hittites were contemporary with the Trojan and the Achean Greeks.


47 posted on 07/03/2019 3:53:55 PM PDT by Tallguy (Facts be d@mned! The narrative must be protected at all costs!)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Red Badger

Very good find man. Scandinavians... Vikings... origin of the Sea Peoples...

Their very existence depended on the sea and beyond, just like the Inuits. Good thing the fish provided vitamin D or they would have not have advanced as a species and culture. Very little sunlight most of the year required a supplemental source of D to continue. It was an accident they survived...


48 posted on 07/03/2019 3:56:14 PM PDT by Openurmind
[ Post Reply | Private Reply | To 1 | View Replies]

To: Boogieman

“It seems to me this situation, with waves of Greek warriors/mercenaries suddenly appearing on the far side of the sea, is probably linked to the end of the Trojan war.”

A pretty good theory. Pre-modern armies were difficult to completely disband. One war ends and the surviving troops from all sides are looking to get paid. Sure some will go home, but the best will follow their captains and go the mercenary route.


49 posted on 07/03/2019 4:01:05 PM PDT by Tallguy (Facts be d@mned! The narrative must be protected at all costs!)
[ Post Reply | Private Reply | To 36 | View Replies]

To: Two Kids' Dad

After a week’s visit with my worthless brother-in-law (If you know him he probably owes you money), I felt like a Philistine slain by the jawbone of an ass.


50 posted on 07/03/2019 4:21:46 PM PDT by Ruy Dias de Bivar
[ Post Reply | Private Reply | To 4 | View Replies]

To: Vigilanteman
"The Spanish were in the Americas a mere century longer than the English (fall of Mexico City, 1521— landing at Plymouth Rock, 1620) but their DNA is far more blended with Native and African DNA than descendants of their counterparts of primarily English ancestry . . . in a mere century, less than 1.7% of recorded human history."

It isn't just time....religious aspects are also in action. The Spanish Roman Catholic perspective did not object to intermarriage with local populations nearly as strongly as the English Protestants, although such intermarriages certainly happened.

51 posted on 07/03/2019 6:49:06 PM PDT by Wonder Warthog (The Hog of Steel and NRA Life Member)
[ Post Reply | Private Reply | To 17 | View Replies]

Ancient DNA sheds light on the genetic origins of early Iron Age Philistines

Fig. 1 Overview of locations and ages of analyzed individuals. (A) Locations of newly reported and other selected published genomes. The newly reported Ashkelon populations are annotated in the upper corner. (B) The range of average ages of the ancient groups is given in thousands of years (ka) BCE.

Fig. 2 PCA and ADMIXTURE analysis. (A) Ancient genomes (marked with color-filled symbols) projected onto the principal components inferred from present-day west Eurasians (gray circles) (fig. S2). The newly reported Ashkelon populations are annotated in the upper corner. (B) ADMIXTURE analysis. A selected set of ancient individuals (as well as present-day Sardinians) is plotted (K = 9 was chosen since it is the cluster number that maximizes components correlated to the most differentiated populations in the west Eurasian PCA).

Fig. 3 European-related admixture detected in ASH_IA1. (A) ASH_IA1 shares access affinity with European-related populations compared to ASH_LBA. We plot the top and bottom 40 values of f4 (ASH_IA1, ASH_IA2; X, Mbuti) on the map. Circles mark the ancient populations and triangles the present-day ones. Z-scores calculated by 5-centimorgan block jackknifing are represented by the size of the symbols. “X” share more alleles with ASH_IA1 when values are positive and with ASH_IA2 when negative. The five groups with the most positive values are annotated on the map (Z > 2.3). (B) We plot the ancestral proportions of the Ashkelon individuals inferred by qpAdm using Iran_ChL, Levant_ChL, and WHG as sources ±1 SEs. P values are annotated under each model. In cases when the three-way model failed (χ2P < 0.05), we plot the fitting two-way model. The WHG ancestry is necessary only in ASH_IA1.

52 posted on 07/03/2019 6:54:54 PM PDT by Theoria (I should never have surrendered. I should have fought until I was the last man alive)
[ Post Reply | Private Reply | To 50 | View Replies]

To: Vigilanteman
The Phoenicians were sea people who planted the colony which became the City State of Carthage about 800 BC. I had always assumed they were a branch of the Philistine Tree.

Not at all. the Philistine "branch" of the Indo-European, I'm going to venture "Hellenistic/pre-Hellenistic "Greek"" tree was assimilated by the neighbouring Judea by the 800s BC

The Phoenicians - or to give them their endonum, Kanaanites - were along the Lebanese coast from at least 2000 BC

53 posted on 07/03/2019 9:03:23 PM PDT by Cronos (Re-elect President Trump 2020!)
[ Post Reply | Private Reply | To 11 | View Replies]

To: yarddog

They initially worshipped chthonic gods, then canaanite gods, then were assimilated by Judeans


54 posted on 07/03/2019 9:07:11 PM PDT by Cronos (Re-elect President Trump 2020!)
[ Post Reply | Private Reply | To 16 | View Replies]

To: mountainlion
The Philistines didn't get wiped out in war - they had already disappeared by the time the Assyrians came in the 700s BC

And while you are right that the Romans destroyed Israel and named it after their ancient, disappeared enemies, the name Philistia had stuck on in Egyptian and Hellenistic kingdoms as a memory of a forgotten people. And the reason for the destruction of ISrael was the Bar Kochkba revolt which followed the Kitos rebellion when Judeans slaughtered the gentile populations of Cyprus and Cyrene -Dio Cassius says that the two provinces were completely depopulated

55 posted on 07/03/2019 9:15:25 PM PDT by Cronos (Re-elect President Trump 2020!)
[ Post Reply | Private Reply | To 21 | View Replies]

To: chajin

The ancient Hebrews knew the Hittites and the phoenicians so I think the sea peoples were a different group.

Many scholars think that Troy was a client state of the Hittite empire and that the Trojan war was a war between the ancient greeks and the client state (troy).

They had found some tablets referring to this when excavating the Hittite ruins. I think the Hittite name for Troy was Wilesa or something similar.


56 posted on 07/03/2019 10:08:37 PM PDT by crusher2013
[ Post Reply | Private Reply | To 9 | View Replies]

To: Born to Conserve; SunkenCiv

Yes a good introduction and here is 8 h of his book
https://www.youtube.com/watch?v=qktm6GvvnWU


57 posted on 07/03/2019 10:11:29 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 33 | View Replies]

To: yarddog

The Bible says they worshipped a fish-god by the name of Dagon.


58 posted on 07/03/2019 10:31:07 PM PDT by AnalogReigns (Real life is ANALOG!!!)
[ Post Reply | Private Reply | To 16 | View Replies]

To: yarddog

He did—when fleeing from Saul. Feigned insanity so they would consider him harmless. Killed a bunch of them before that, and later too, in battle.

Interestingly, the list of names of David’s “Mighty Men” (his chief warriors) include many Philistine names....
meaning, certain Philistines became loyal to David, and became worshipers of Yahweh.


59 posted on 07/03/2019 10:37:04 PM PDT by AnalogReigns (Real life is ANALOG!!!)
[ Post Reply | Private Reply | To 31 | View Replies]

To: Theoria

Is this from a website? If so I would like the address for reference.


60 posted on 07/04/2019 6:35:23 AM PDT by mountainlion (Live well for those that did not make it back.)
[ Post Reply | Private Reply | To 52 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-80 ... 101-111 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson