Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Live stream of Norad Santa Tracker 2020
Norad Santa ^ | Christmas Eve 2020 | Norad

Posted on 12/24/2020 4:16:30 AM PST by Morgana

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-42 next last
To: A Formerly Proud Canadian
Is Santa a ‘super spreader’? Careful, Santa. You may be arrested in many States and Provinces!

I hope he has upgraded his sled with stealth and his chaff and flairs are up dated. If the dems can get a lock they will try to take him down.

21 posted on 12/24/2020 9:23:46 AM PST by usurper ( version )
[ Post Reply | Private Reply | To 5 | View Replies]

To: usurper

Who knows. Perhaps some of the money that PDJT provided to upgrade the US Forces, got passed to Santa. I hope he brought lots of coal to give to the demonrat pols! Perhaps he’ll drop a couple of pounds of bacon each, for Keith, André, Ilhan and Rashida! BACON CHANGES EVERYTHING!


22 posted on 12/24/2020 9:36:24 AM PST by A Formerly Proud Canadian (I once was blind but now I see... )
[ Post Reply | Private Reply | To 21 | View Replies]

To: floralamiss

He does have to watch out for evil demonrats, as do we!

Merry Christmas to you and yours!


23 posted on 12/24/2020 9:39:20 AM PST by A Formerly Proud Canadian (I once was blind but now I see... )
[ Post Reply | Private Reply | To 16 | View Replies]

To: AbolishCSEU

Yep.
They have him riding in the sleigh face diapered up.


24 posted on 12/24/2020 10:32:29 AM PST by 07Jack
[ Post Reply | Private Reply | To 12 | View Replies]

To: Morgana

Sorry, while Santa was vaccinated (Dr. Fraudci said so, so it has to be true) the elves weren’t, and one of them coughed, so the entire North Pole operation has been quarantined.

So no Santa Clause this year.


25 posted on 12/24/2020 10:35:16 AM PST by PAR35
[ Post Reply | Private Reply | To 1 | View Replies]

To: dp0622

He cleared Russia, now over Finland . . .


26 posted on 12/24/2020 11:33:00 AM PST by BraveMan
[ Post Reply | Private Reply | To 7 | View Replies]

To: floralamiss

That’s great that Santa’s immune! (Especially with his comorbidity factors.)

I figured he talked with Fauci, padded the DHHS’s pocketbook a bit and got the green light.


27 posted on 12/24/2020 11:54:36 AM PST by polymuser (A socialist is a communist without the power to take everything from their citizens...yet.)
[ Post Reply | Private Reply | To 16 | View Replies]

To: Morgana

Thank you for a bit of magic in such an awful year!

God bless you!

‘Face

:o])


28 posted on 12/24/2020 12:20:56 PM PST by Monkey Face (Following Christ isn't an easy road but it's the ONLY road worth following.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: polymuser

Funny, but I heard some sick bastage earlier this year say that it’s a great way to get out of buying presents for the kids by saying that Santa got taken out by the Rona.


29 posted on 12/24/2020 12:50:01 PM PST by hoagy62 (DTCM&OTTH)
[ Post Reply | Private Reply | To 27 | View Replies]

To: hoagy62

Santa Got Run Over by Corona


30 posted on 12/24/2020 1:11:37 PM PST by polymuser (A socialist is a communist without the power to take everything from their citizens...yet.)
[ Post Reply | Private Reply | To 29 | View Replies]

To: dp0622

When I was a kid, every year my dad would come home from work at midnight and tell me he’d shot the deer that he found standing on our roof.


31 posted on 12/24/2020 3:35:23 PM PST by Salamander (There's Nothing For It But To Sit And Wait For The Hard Men To Get Me Out....)
[ Post Reply | Private Reply | To 7 | View Replies]

To: Morgana

It’s been a few years since I looked at the Santa Tracker. It appears they upgraded the site quite a bit.


32 posted on 12/24/2020 3:47:30 PM PST by 2111USMC (Aim Small Miss Small)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Salamander

LOL!

That explains alot about you!


33 posted on 12/24/2020 4:13:27 PM PST by lizma2
[ Post Reply | Private Reply | To 31 | View Replies]

To: lizma2

Ain’t that the truth.

My childhood was like some weird Monty Python skit.


34 posted on 12/24/2020 4:40:50 PM PST by Salamander (There's Nothing For It But To Sit And Wait For The Hard Men To Get Me Out....)
[ Post Reply | Private Reply | To 33 | View Replies]

To: PAR35
Elves aren’t human and not vulnerable to Corona, however one of the Elves has been sent elsewhere...


35 posted on 12/24/2020 4:54:53 PM PST by GreenLanternCorps (Hi! I'm the Dread Pirate Roberts! (TM) Atsk about franchise opportunities in your area.)
[ Post Reply | Private Reply | To 25 | View Replies]

To: Morgana

Is Santa wearing a mask? 😷


36 posted on 12/24/2020 7:14:57 PM PST by MinorityRepublican
[ Post Reply | Private Reply | To 1 | View Replies]

To: 2111USMC

They still can’t get it right.

Another reason to be grateful our son is past Santa now. They cannot get the timing and sequence of travel reasonable.

We lived on the edge all the time because the tracker would be indicating Santa would be here around 10:30. Ridiculous!

For starters they need to stop acting like Santa is everyplace at 12. 3 am would be a better time to aim for.


37 posted on 12/24/2020 7:39:34 PM PST by the OlLine Rebel (Common sense is an uncommon virtue./Federal-run medical care is as good as state-run DMVs. I )
[ Post Reply | Private Reply | To 32 | View Replies]

To: Morgana

Thanks for posting this! Is there any sound? There used to be audio on this site.


38 posted on 12/25/2020 1:34:15 AM PST by nutmeg (Mega prayers for Rush Limbaugh)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Morgana

Big red in the house

https://twitter.com/SecretService/status/1342127907221741570


39 posted on 12/25/2020 10:46:45 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: LateBoomer; Bobalu; Monkey Face; nutmeg; Chode

I knew you all needed this. Merry Christmas


40 posted on 12/25/2020 11:57:56 AM PST by Morgana ( Always a bit of truth in dark humor. )
[ Post Reply | Private Reply | To 3 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-42 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson