1 posted on
06/30/2011 7:44:18 PM PDT by
decimon
To: SunkenCiv; SJackson
2 posted on
06/30/2011 7:45:02 PM PDT by
decimon
To: decimon
They should use this to definitively determine who ghost wrote the Audacity of Hope for Obama (hint: it was Ayers)
3 posted on
06/30/2011 7:47:29 PM PDT by
Teotwawki
(To Him be the glory throughout all generations.)
To: decimon
They needed a computer code to tell them that? The Bible plainly states it was written by multiple authors. Under the guidance of the Holy Spirit.
2Pe 1:21 For the prophecy came not in old time by the will of man: but holy men of God spake as they were moved by the Holy Ghost.
6 posted on
06/30/2011 8:04:48 PM PDT by
Salvavida
(The restoration of the U.S.A. starts with filling the pews at every Bible-believing church.)
To: decimon
academic researchers have believed the text was written by a number of different authors whose work could be identified by seemingly different ideological agendas and linguistic styles and the different names they used for God.**************
These so called academic researchers are as dumb as a box of rocks if they believe the different names used of God are an indicator of authorship. They would have to have zero understanding of the Biblical text to believe such a thing.
7 posted on
06/30/2011 8:05:30 PM PDT by
bereanway
To: decimon
For millions of Jews and Christians, it's a tenet of their faith that God is the author of the core text of the Hebrew Bible No it isn't. We believe that God inspired the individuals who physically wrote the text. Big difference. Of course there will be different styles of writing that can be attributed to different authors.
8 posted on
06/30/2011 8:16:29 PM PDT by
BuckeyeTexan
(There are those that break and bend. I'm the other kind. *4192*)
To: decimon
Hmmm... how do we know the programming code isn’t slanted towards the code writer’s beliefs? Computers are just hardware and do what they are told. People write programming code.
9 posted on
06/30/2011 8:16:57 PM PDT by
jeffc
(Prayer. It's freedom of speech.)
To: decimon
Years ago I read some stuff by and about a Russian mathematician, Ivan Panin, whose works involved converting the Canon into a mathematical sequence, since supposedly hebrew, chaldee and greek letters also represented numbers. The claim was that the numerical patterns were violated by omissions or extra-canonical text, hence the true Bible could be deduced or extracted. This was before the PC revolution and I have not seen anything since—
14 posted on
06/30/2011 8:33:43 PM PDT by
One Name
To: decimon
Software developed by an Israeli team is giving intriguing new hints about what researchers believe to be the multiple hands that wrote the Bible. The new software analyzes style and word choices to distinguish parts of a single text written by different authors, and when applied to the Bible its algorithm teased out distinct writerly voices in the holy book. "German higher criticism" codified?
"If you believed Moses, you would believe me, for he wrote about me."
-- John 5:46
15 posted on
06/30/2011 8:40:44 PM PDT by
Alex Murphy
(Posting news feeds, making eyes bleed: he's hated on seven continents)
To: decimon
Science, falsely so called.
17 posted on
07/01/2011 4:31:39 AM PDT by
Old Landmarks
(No fear of man, none!)
To: decimon
Dreams from my Father anyone?
18 posted on
07/01/2011 4:47:45 AM PDT by
jimfree
(In 2012 Sarah Palin will have more quality executive experience than Barack Obama.)
To: decimon; SunkenCiv
28 posted on
07/02/2011 4:47:49 AM PDT by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson