Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Edward Snowden: Apple iPhone with Secret iFeature Allows Government to Spy on You
Tech Times ^ | January 24, 9:59 AM | Aaron Mamiit

Posted on 01/24/2015 8:40:48 PM PST by DUMBGRUNT

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-73 next last
To: ProtectOurFreedom
Just like they did to Attkisson.

Attkisson was compromised by actual physical invasion of her house and computer. They actually installed an extra fiber channel line into her house and computer. There was no remote software attack made. If you have physical access to ANY computer, the game is over. They own you.

21 posted on 01/25/2015 12:41:35 AM PST by Swordmaker (This tag line is a Microsoft insult free zone... but if the insults to Mac users contnue...)
[ Post Reply | Private Reply | To 6 | View Replies]

To: Candor7
Some of the cell phones comprise health risks through radiation. Too many users have contracted tumors in the ear area, not to notice.

Please provide proof of your assertions. Not anecdotal. PROOF.

In the meantime, the American Cancer Society has this to say about cell phone signals.

As noted above, the RF waves given off by cell phones don’t have enough energy to damage DNA directly or to heat body tissues. Because of this, many scientists believe that cell phones aren’t able to cause cancer. Most studies done in the lab have supported this theory, finding that RF waves do not cause DNA damage.

Some scientists have reported that the RF waves from cell phones produce effects in human cells (in lab dishes) that might possibly help tumors grow. However, several studies in rats and mice have looked at whether RF energy might promote the development of tumors caused by other known carcinogens (cancer-causing agents). These studies did not find evidence of tumor promotion.


22 posted on 01/25/2015 1:00:55 AM PST by Swordmaker (This tag line is a Microsoft insult free zone... but if the insults to Mac users contnue...)
[ Post Reply | Private Reply | To 10 | View Replies]

To: 867V309
You probably believe Google and Facebook aren't spies either.

No, we KNOW that Google spied on us. . . for their own purposes at least. They tell us they are. So does Facebook. There is nothing private on Facebook. Would you plan on putting ANYTHING you wanted to keep secret to Facebook? I wouldn't.

23 posted on 01/25/2015 1:03:12 AM PST by Swordmaker (This tag line is a Microsoft insult free zone... but if the insults to Mac users contnue...)
[ Post Reply | Private Reply | To 8 | View Replies]

To: max americana
Hilarious. Google, facebook and apple are the biggest Dem contributors. Anything that Buttcrack Odumbo says , they do.

Actually, historically, under Steve Jobs, Apple was not a major contributor. Look it up. They have given far less to politicians and political causes than most other technical companies. They have generally avoided it. In fact when one Democrat politician asked Jobs why Apple was not more forthcoming with support, Jobs is reported to have replied that "Half of Apple's customers are Republicans. I don't intend to anger half of our Apple customers from either side, so we don't make political contributions." For the most part, throughout Steve Jobs tenure, Apple stuck to that corporate policy.

Microsoft, Intel, Google, Dell, Facebook, and others gave a LOT more than Apple to Democrats than Apple ever did.

Even privately, in the 12 years leading up to his death, Jobs' political contributions were meager compared to other billionaires, totaling less than $200,000. Since his death his wife is much more politically active.

Apple does have an Employees Political Action Committee, but that is not controlled by Apple. Contributions from that organization has generally split donations between Democrat and Republican candidates by about 80-20. . . but it is a purely voluntary organization.

I think that no politics policy is changing under Tim Cook.

24 posted on 01/25/2015 1:16:43 AM PST by Swordmaker (This tag line is a Microsoft insult free zone... but if the insults to Mac users contnue...)
[ Post Reply | Private Reply | To 11 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...

Thanks Swordmaker.

http://www.freerepublic.com/focus/chat/3250391/posts?page=19#19


25 posted on 01/25/2015 1:27:10 AM PST by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 19 | View Replies]

To: DUMBGRUNT

Don’t tell swordmaker


26 posted on 01/25/2015 1:29:34 AM PST by wardaddy (glenn beck is a nauseous politically correct conservative on LSD)
[ Post Reply | Private Reply | To 1 | View Replies]

To: DUMBGRUNT
"Edward never uses an iPhone; he's got a simple phone," said the lawyer of Snowden, Anatoly Kucherena, in an interview with the Russian media company RIA Novosti.

Here is what REALLY is going on. Note that this did not really come directly from Snowden. . . but rather from Anatoly Kucherena, Snowden's Russian government appointed attorney, through an interview with a Russian media company RIA Novosti. . . which under Putin is back to being the same as Pravda! was under the old Soviet Union, a state directed propaganda mill. The distinction is important.

Why do I say this is important?

It is because Putin and the Russian government are using Apple as a proxy in its battle with the West. Back in November they started with a shot across the bow . . . they demanded that all data in smartphones in Russia must be stored in servers in Russia. The only company that edict affected would be Apple and Apple iPhones and iPads with the iCloud storage systems with their automatic iCloud linking. . . although there was some possibility it might have some effect on how Facebook might work in Russia. Apple's servers for Western Russia are in Northern Europe. When Apple informed the Russian government it would take time to build server facilities in Russia, Russia responded with an outright ban on sales of iPhones, iPads, and other iOS devices effective January 1, 2015.

Apple iPhone and iPad 'Banned in Russia' from 2015 "

Simultaneously with the Russian Government went on a campaign for Russian people to use home grown smartphones. . . and the Russian government ordered the tearing down of the memorial statue of Steve Jobs erected in St. Petersburg just a year ago under the pretext that it was about Tim Cook admitting he was gay.

Russian Officials Tear Down Steve Jobs Statue After Current CEO Tim Cook Comes Out

In December, with the world oil prices hitting new lows, the Ruble was crashing and Apple raised Russia App Store and iTunes prices by 35% to reflect the deflation of the currency in Russian Federation. Apple also shut down the Apple Online Store and then reopened it with 25% higher prices.

Apple Raises IPhone Price 25% In Russia After Ruble Drops

Russia was NOT pleased.

Russia orders the sale of the Steve Jobs statue at auction to raise funds. LOL!

Shortly after the 25% increase, Apple shut down the Russian App Store and iTunes store again, and when it re-opened, prices of music and apps had increased by 100% because the Ruble had devalued so much more in just a month.

Apple Forced To Raise App Prices By 100% In Russia Days After Stopping Online Sales

The war between Russia and Apple keeps escalating. . . with the Russian government pressuring its citizens to buy homegrown cellular phones. . . and bad mouthing western products. What Russia does NOT need is for Rubles to be spent on imported items. . . especially expensive ones such as iPhones.

Then last week, Apple, as required by our State Department, cut off the iPhone developers in Crimea.

Apple Cuts Off Developers In Crimea Following U.S. Sanctions"

And then, shortly afterwards, Apple dropped the other shoe, required by our State Department and stopped all product sales in Crimea:

Apple pulls switch on products in Crimea over US-Russia standoff"

further tweaking Putin and Russia!

How could Putin and the Russians strike back at Apple and the West in this economic war without economic weapons?

Striking at Apple would be easy by striking at the integrity of their flagship product's sales by impugning its security and safety for its customers. Strike a propaganda blow at the West's weakest public relations failure of the past decade, the NSA scandal. . . and they can do it with one blow. This is very well thought out attack with the SNOWDEN BOMB!

This reported statement from Snowden is exactly the kind of thing that plays into both memes. . . a slap at Apple and builds the FUD in potential Russian iPhone customers about buying a phone that may have built in spyware, literally a twofer propaganda ploy. It literally is brilliant when you think about it.

27 posted on 01/25/2015 2:17:01 AM PST by Swordmaker (This tag line is a Microsoft insult free zone... but if the insults to Mac users contnue...)
[ Post Reply | Private Reply | To 1 | View Replies]

To: VerySadAmerican
Local police can turn your cheap phone on.

Your local theater can take over your cheap (or, preferably, your not-so-cheap) phone. It's just a few keystrokes.

Example.

28 posted on 01/25/2015 2:24:48 AM PST by cynwoody
[ Post Reply | Private Reply | To 4 | View Replies]

To: Swordmaker; Candor7
In order to break a chemical bond in the human body you need an energy of a few eV. http://en.wikipedia.org/wiki/Bond-dissociation_energy

The energy from cell phones are more than 1000 times smaller http://en.wikipedia.org/wiki/Microwave so there is no risk from that. The content of the phone call might be harmful though ;-)

29 posted on 01/25/2015 2:51:37 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22 | View Replies]

To: Swordmaker

It’s not FUD.

Under CALEA all software and hardware are required to give the government a backdoor key or access in some way.

CALEA even includes transmission.

They “invested” in companies and by law have access to technologies that they are part owner in.

As for the claim of backdoor, I doubt it will have any measurable effect on Apple sales.

Apple is a unique eco-system of “Gotta Have it” and “Fandom”

Besides, they make things that just plain work better.

That said, I don’t a single Apple product.

Mostly because I want to work on stuff I already know how to work with. Not that I can’t learn Apple just don’t feel like it.

Also, after I built my version of a dual processor 486-Dx2-66, mounted with a Creative Labs sound card, two 8meg Matrox video cards and my then gigantic 21” CAD/CAM Color CRT by Radius, someone put a sticker on my computer that read “It Smells Inside”.

I don’t want to say who it Woz but, the guy is a pretty big deal in the computer industry.

Might have even been on his employees at Cloud 9 for all I know.

That’s not really the reason but, that did happen and I no one ever fessed up to messing with my kewel azz machine.


30 posted on 01/25/2015 3:33:51 AM PST by Vendome (Don't take life so seriously-you won't live through it anyway-Enjoy Yourself ala Louis Prima)
[ Post Reply | Private Reply | To 19 | View Replies]

To: VerySadAmerican

Then they should pay my bill as I average less than 2 min. a month over several years. Gots me a Capt Kirk special - mil spec even.


31 posted on 01/25/2015 4:55:21 AM PST by mcshot (OMG We're going down!)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Candor7
I have a cheap one with minimum monthly cost, no contract and no minutes included. It's only for emergencies or to bring on a road trip. It's never on.

What's irritating is all of the user fees and taxes on a phone I don't use. Don't they subsidize free phones for those who get 250 minutes a month included for free?

32 posted on 01/25/2015 5:53:17 AM PST by grania
[ Post Reply | Private Reply | To 7 | View Replies]

To: F15Eagle
Some still do not understand how Google just magically has all the money in the world to do whatever they want, amazingly.....

The money doesn't appear magically.

People use Google billions of times per day to search for things. Google returns the items that people search for, but on the right-hand side they also return ads for items that correspond to the search**. If someone clicks one of those right-hand ads, the advertiser is charged anywhere from a few cents to a few dollars. Multiply that by millions upon millions of clicks, and it's a massive amount of money.

What I'm saying is that there's no reason for conspiracy-think where it's not warranted, and in the case of Google and Facebook their revenue is pretty easy to discern.

**Depending on your settings, you might see 'promoted' results in the center of the page, which are also paid ads.

33 posted on 01/25/2015 6:49:31 AM PST by IncPen (None of this would be happening if John Boehner were alive...)
[ Post Reply | Private Reply | To 13 | View Replies]

To: lightman

Thank you!
I added that to the keyword list.


34 posted on 01/25/2015 7:31:29 AM PST by DUMBGRUNT (BINGO!)
[ Post Reply | Private Reply | To 2 | View Replies]

To: VerySadAmerican

Oh no!
That will add to my minutes!!!

That’s not right!


35 posted on 01/25/2015 7:33:10 AM PST by DUMBGRUNT (BINGO!)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Candor7
I will never own one. I find them invasive and irritating.

YES,YES,YES!

That said , they are far better than my oatmeal box and string.

36 posted on 01/25/2015 7:36:25 AM PST by DUMBGRUNT (BINGO!)
[ Post Reply | Private Reply | To 7 | View Replies]

To: o-n-money
Is this another pro-American tidbit from Snowden?

Methinks this is Putin attempting to kick AAPL.

37 posted on 01/25/2015 7:40:27 AM PST by DUMBGRUNT (BINGO!)
[ Post Reply | Private Reply | To 15 | View Replies]

To: dalereed

AAPL: Buy on the rumor, sell on the news!

$o far so good.


38 posted on 01/25/2015 7:43:14 AM PST by DUMBGRUNT (BINGO!)
[ Post Reply | Private Reply | To 17 | View Replies]

To: Swordmaker
Even Apple cannot decrypt user data that is stored on the servers.

Sounds like the proper design for a 'Doomsday Machine'.

39 posted on 01/25/2015 7:47:13 AM PST by DUMBGRUNT (BINGO!)
[ Post Reply | Private Reply | To 20 | View Replies]

To: fireman15

I have to remember to turn off WiFi and/or Bluetooth after I have used them in a hospital or in the car. They are sieves.

My son in law called my daughter prior to leaving work the other day. He asked her if she wanted Wendy’s. I guess they never eat there. After she hung up, she started looking at something on her phone, and up popped an ad for Wendy’s. Within two minutes of her phone conversation. She texted me to tell me about it. Then she started researching voice recognition software and links to advertisers, and she found that companies are listening in to conversations and targeting ads to users that way.


40 posted on 01/25/2015 7:55:46 AM PST by petitfour
[ Post Reply | Private Reply | To 12 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-73 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson