Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Weird Cat Facts: 8 Reasons Your Cat Likes to Lick You
Catster ^ | Feb 23rd 2015 | JaneA Kelley

Posted on 03/03/2015 3:50:18 PM PST by Slings and Arrows

Today’s weird science question comes from Kendraw:

“My cat is obsessed with licking me. She will tolerate pets, but what she really wants to do when she needs attention is to lick me anywhere she can get skin. She won't lick my face, thank goodness, but my arm, elbow, and hand are fair game! She will literally hold me down in her paws and clean me. And it's not just a few licks; she gets quite thorough about it. I've tried bitter spray. No luck. I know it’s a sign of affection, but is there any way I can gently get her to stop?”

"Love You,” (CC-BY-SA) by Doryana02

Well, Kendraw, you’ve got a question and I’ve got some answers. First I’ll talk about why cats lick, and then I’ll give you some tips on how to persuade your cat that there are much more awesome options than grooming you until your skin is raw.

1. Licking is a means of social bonding

Kittens groom each other, and older cats who aren’t related but get along well also spend time grooming one another. Often they’ll get the spots that are hard for a cat to reach by themselves, such as the top of the head and inside the ears. Exchanging scents through grooming also increases the bond between a pair of cats. (One Catster writer documented her attempt at licking her cat back.)

My cats, Thomas and Dahlia, loved to groom each other.

2. When your cat licks you, she’s paying you a huge compliment

A tongue bath from your cat is an indication that she feels totally safe in your presence. You are truly a member of her family, and she reinforces that by cleaning you like her mother cleaned her when she was a kitten.

3. Your cat’s tongue is covered with barbs

Your kitty's tongue feels like sandpaper because it’s covered with papillae -- backward-facing hooks made of keratin, the same material that makes your kitty’s claws. The papillae help cats rasp meat off bones, and they also assist in grooming by acting like a comb to pull out loose fur and dirt.

Cat tongue, (CC-BY) by Jennifer Leigh

4. Your cat might be licking you because of anxiety

Some cats get so stressed that they begin licking compulsively. (One mysterious condition is called feline hyperesthesia.) Cats who lick themselves bald are often trying to comfort themselves because they’re stressed. Other compulsive kitties might lick and suck on fabric, plastic, or even your skin.

5. To stop your cat from licking you, distract her

Learn the signs that your cat is about to start licking. Before she starts washing your arm raw, redirect her attention with a toy. If your cat likes catnip, slip a catnip-filled kicker toy in front of her when she’s about to lick you. If she’s not a catnip fan, try a treat-dispensing toy instead.

Playing kitten, (CC-BY-SA) by Stephan Czuratis

6. De-stress your cat with interactive play

Play is always good. It keeps your cat fit and trim, and it strengthens the bond between you. Not only that, but the chemicals released during exercise help your cat to relax and feel content.

7. Be patient

It’s not easy to retrain a cat who has gotten used to performing a habitual behavior such as licking. Remember to stay gentle and avoid yelling or intense physical reactions like shoving your cat, tossing her off your lap, or (heaven forbid) hitting her.

Sure, cats lick us all they want, but do they dig it when we try to lick them? Uh, not so much.



TOPICS: Pets/Animals
KEYWORDS: kittyping
Navigation: use the links below to view more comments.
first previous 1-2021-4041-48 last
To: wyokostur

“Thought they were taste testing me to see what I will taste like when they kill me.”

That’s true. But I had also heard that this is the way they obtain DNA samples to send back to the Mother Ship.


41 posted on 03/04/2015 11:37:32 AM PST by MplsSteve
[ Post Reply | Private Reply | To 26 | View Replies]

To: Rodamala

Thank you for the ping.

I’m in the middle of chemotherapy, and I stink! My cats do not
lick me now, but when it’s over, I’m sure they’ll resume again.


42 posted on 03/04/2015 12:30:56 PM PST by TheOldLady (Pray for Obama... Psalm 109:8 -- Look it up...... I donate monthly. Do you?)
[ Post Reply | Private Reply | To 28 | View Replies]

To: Gefn
I love the way their tongues are like sandpaper.

I had a cat who would jump in bed with me and lick my eyelids if I didn't get up to feed her in the morning at the time she thought she should be fed. OUCH!! That sandpaper tongue was not so attractive at that moment.

43 posted on 03/04/2015 12:36:25 PM PST by Hoffer Rand (Bear His image. Bring His message. Be the Church.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Daffynition

love that....funny


44 posted on 03/04/2015 1:51:29 PM PST by goat granny
[ Post Reply | Private Reply | To 27 | View Replies]

To: Slings and Arrows

Andy never licks me…he nudges tho.


45 posted on 03/04/2015 4:11:21 PM PST by Veto! (Opinions freely dispensed as advice)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Veto!

Kitty head-butts rock.


46 posted on 03/04/2015 8:10:21 PM PST by Slings and Arrows ("Heaven (I'm Already There)" - http://youtu.be/Eh_eGF3xvmw)
[ Post Reply | Private Reply | To 45 | View Replies]

To: RushIsMyTeddyBear

Mine likes to lick all the lotion off my hands


47 posted on 03/04/2015 9:25:29 PM PST by Califreak (Hope and Che'nge is killing U.S./CDC=Contagion Distribution Center)
[ Post Reply | Private Reply | To 6 | View Replies]

To: Slings and Arrows

Zoonotic Disease: What Can I Catch from my Cat?
http://www.vet.cornell.edu/FHC/health_resources/Zoonotic.cfm


48 posted on 03/05/2015 3:21:57 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-48 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson