To: SunkenCiv; MtnClimber; SuperLuminal
No ‘anti-gravity’?............... 😒
2 posted on
10/06/2023 8:02:19 AM PDT by
Red Badger
(Homeless veterans camp in the streets while illegal aliens are put up in hotels.....................)
To: Red Badger
Darn! Does that mean they have to rewrite all those Sci-Fi novels and movies? Thank God for AI …
3 posted on
10/06/2023 8:05:00 AM PDT by
Governor Dinwiddie
(Lord, grant thy people grace to withstand the temptations of the world, the flesh, and the devil.)
To: Red Badger
Oh BALDERDASH!! More crap based on existing theories. Do ppl ever learn!? There is so much yet to be discovered and learned, around the corner.
7 posted on
10/06/2023 8:16:19 AM PDT by
SgtHooper
(If you remember the 60's, YOU WEREN'T THERE!)
To: Red Badger
If there is no such thing as antigravity, what causes my cow to occasionally fly up into the air?
Answer that one, fancy physics researchers.
9 posted on
10/06/2023 8:17:34 AM PDT by
Leaning Right
(The steal is real.)
To: Red Badger
10 posted on
10/06/2023 8:18:23 AM PDT by
Magnum44
(...against all enemies, foreign and domestic... )
To: Red Badger
No wonder it fell. Anti Gravity particles have half the mass as Gravity particles. Sheesh...Duhhh!!!!
To: Red Badger
UFO manufacturers and pilots would disagree.
12 posted on
10/06/2023 8:24:57 AM PDT by
Rennes Templar
(Come back, President Trump.)
To: Red Badger; SaveFerris; PROCON; gundog; Gamecock
Antimatter itself is very real. Made of particles that mostly behave like regular matter, but their electrical charges are reversed, an anti-proton looks just like a proton but has a negative charge, while an anti-electron (or positron) looks and moves just like an electron but has a positive charge. When a bit of antimatter bumps into a bit of matter, they explodeSo, a Bizzaro World.
14 posted on
10/06/2023 8:33:02 AM PDT by
Larry Lucido
(Donate! Don't just post clickbait!)
In the pursuit of antigravity, they unwittingly discovered antitime
15 posted on
10/06/2023 8:34:47 AM PDT by
Gene Eric
(Don't be a statist!)
To: Red Badger
Einstein was right. I just confirmed it.
28 posted on
10/06/2023 9:06:11 AM PDT by
UnwashedPeasant
(The pandemic we suffer from is not COVID. It is Marxist Democrat Leftism.)
To: Red Badger
Anti-gravity must exist. B-movie makers can't afford the visual effects to make everything float in a spaceship.
Seems like your anti-matter would have to have negative mass for this to work.
33 posted on
10/06/2023 9:16:43 AM PDT by
Rio
To: Red Badger
This is kind of a good thing.
If you had an antigravity device, but it attracted antimatter to itself, seems like it would then be a pretty useless device as it would pretty quickly be annihilated.
44 posted on
10/06/2023 10:26:48 AM PDT by
chrisser
(I lost my vaccine card in a tragic boating accident.)
To: Red Badger
Awesome experiment...
Awesome result...
Albert rocks!
The more things change, the more they stay the same...
48 posted on
10/06/2023 10:50:14 AM PDT by
SuperLuminal
(Where is the next Sam Adams when we so desperately need him)
To: Red Badger
Gravity is not a traditional force, it’s a distortion of space-time.
Magnetism is a force but has no energy on its own.. it is a good way to convert energy from one form to another i.e. motion to electrical current.
If you could create a sheet of material that could block gravity or magnetism then you would have a perpetual motion machine... it just ain’t possible. It is as silly as the notion of pulling yourself up by the bootstraps...lol
As an aside, the best vehicle that can possibly be made given the current state of technology is a diesel-electric.
Purely battery powered cars await a breakthrough in battery technology that is not yet in sight (compact super-capacitor batteries of small size/weight with enormous capacity and rapid charge times)
A small, clean diesel drives an efficient generator to charge the batteries. The batteries drive the brushless motors in the wheel hubs. No normal braking system required as magnetic braking is excellent, no transmission needed, massive acceleration possible for short durations... no problems running a heater in winter or air conditioning in summer. No waiting to charge your car, it charges itself. You can drive on electric only for quite a few miles to cut pollution inside cities. Diesel is far safer in an accident compared to gasoline - much less danger of fire... i.e. The gas powered Sherman tank was a burning joke compared to German diesel tanks of WW2
51 posted on
10/06/2023 11:13:15 AM PDT by
Bobalu
(The political prosecution of Donald Trump marks the official end of US democracy.)
To: Red Badger
Dark energy
I’m surrounded by it
Help!
I miss baryonic company
52 posted on
10/06/2023 11:14:10 AM PDT by
wardaddy
(Why so many nevertrumpers with early sign ups and no posting history till now? Zot them PTB)
To: Red Badger
Dark energy
I’m surrounded by it
Help!
I miss baryonic company
54 posted on
10/06/2023 11:15:20 AM PDT by
wardaddy
(Why so many nevertrumpers with early sign ups and no posting history till now? Zot them PTB)
To: Red Badger
Thank you for the article.
60 posted on
10/07/2023 2:33:29 AM PDT by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson