Free Republic
Browse · Search
General/Chat
Topics · Post Article


1 posted on 10/06/2023 7:57:56 AM PDT by Red Badger
[ Post Reply | Private Reply | View Replies ]


To: SunkenCiv; MtnClimber; SuperLuminal

No ‘anti-gravity’?............... 😒


2 posted on 10/06/2023 8:02:19 AM PDT by Red Badger (Homeless veterans camp in the streets while illegal aliens are put up in hotels.....................)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger
Darn! Does that mean they have to rewrite all those Sci-Fi novels and movies? Thank God for AI …

3 posted on 10/06/2023 8:05:00 AM PDT by Governor Dinwiddie (Lord, grant thy people grace to withstand the temptations of the world, the flesh, and the devil.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Oh BALDERDASH!! More crap based on existing theories. Do ppl ever learn!? There is so much yet to be discovered and learned, around the corner.


7 posted on 10/06/2023 8:16:19 AM PDT by SgtHooper (If you remember the 60's, YOU WEREN'T THERE!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger
If there is no such thing as antigravity, what causes my cow to occasionally fly up into the air?
Answer that one, fancy physics researchers.


9 posted on 10/06/2023 8:17:34 AM PDT by Leaning Right (The steal is real.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

10 posted on 10/06/2023 8:18:23 AM PDT by Magnum44 (...against all enemies, foreign and domestic... )
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

No wonder it fell. Anti Gravity particles have half the mass as Gravity particles. Sheesh...Duhhh!!!!


11 posted on 10/06/2023 8:20:19 AM PDT by ImJustAnotherOkie
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

UFO manufacturers and pilots would disagree.


12 posted on 10/06/2023 8:24:57 AM PDT by Rennes Templar (Come back, President Trump.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger; SaveFerris; PROCON; gundog; Gamecock
Antimatter itself is very real. Made of particles that mostly behave like regular matter, but their electrical charges are reversed, an anti-proton looks just like a proton but has a negative charge, while an anti-electron (or positron) looks and moves just like an electron but has a positive charge. When a bit of antimatter bumps into a bit of matter, they explode

So, a Bizzaro World.


14 posted on 10/06/2023 8:33:02 AM PDT by Larry Lucido (Donate! Don't just post clickbait!)
[ Post Reply | Private Reply | To 1 | View Replies ]

In the pursuit of antigravity, they unwittingly discovered antitime


15 posted on 10/06/2023 8:34:47 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Einstein was right. I just confirmed it.


28 posted on 10/06/2023 9:06:11 AM PDT by UnwashedPeasant (The pandemic we suffer from is not COVID. It is Marxist Democrat Leftism.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger
Anti-gravity must exist. B-movie makers can't afford the visual effects to make everything float in a spaceship.


29 posted on 10/06/2023 9:08:03 AM PDT by Angelino97
[ Post Reply | Private Reply | To 1 | View Replies ]

Seems like your anti-matter would have to have negative mass for this to work.


33 posted on 10/06/2023 9:16:43 AM PDT by Rio
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

This is kind of a good thing.

If you had an antigravity device, but it attracted antimatter to itself, seems like it would then be a pretty useless device as it would pretty quickly be annihilated.


44 posted on 10/06/2023 10:26:48 AM PDT by chrisser (I lost my vaccine card in a tragic boating accident.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Awesome experiment...
Awesome result...

Albert rocks!
The more things change, the more they stay the same...


48 posted on 10/06/2023 10:50:14 AM PDT by SuperLuminal (Where is the next Sam Adams when we so desperately need him)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Gravity is not a traditional force, it’s a distortion of space-time.

Magnetism is a force but has no energy on its own.. it is a good way to convert energy from one form to another i.e. motion to electrical current.

If you could create a sheet of material that could block gravity or magnetism then you would have a perpetual motion machine... it just ain’t possible. It is as silly as the notion of pulling yourself up by the bootstraps...lol

As an aside, the best vehicle that can possibly be made given the current state of technology is a diesel-electric.
Purely battery powered cars await a breakthrough in battery technology that is not yet in sight (compact super-capacitor batteries of small size/weight with enormous capacity and rapid charge times)

A small, clean diesel drives an efficient generator to charge the batteries. The batteries drive the brushless motors in the wheel hubs. No normal braking system required as magnetic braking is excellent, no transmission needed, massive acceleration possible for short durations... no problems running a heater in winter or air conditioning in summer. No waiting to charge your car, it charges itself. You can drive on electric only for quite a few miles to cut pollution inside cities. Diesel is far safer in an accident compared to gasoline - much less danger of fire... i.e. The gas powered Sherman tank was a burning joke compared to German diesel tanks of WW2


51 posted on 10/06/2023 11:13:15 AM PDT by Bobalu (The political prosecution of Donald Trump marks the official end of US democracy.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Dark energy

I’m surrounded by it

Help!

I miss baryonic company


52 posted on 10/06/2023 11:14:10 AM PDT by wardaddy (Why so many nevertrumpers with early sign ups and no posting history till now? Zot them PTB)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Dark energy

I’m surrounded by it

Help!

I miss baryonic company


54 posted on 10/06/2023 11:15:20 AM PDT by wardaddy (Why so many nevertrumpers with early sign ups and no posting history till now? Zot them PTB)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Thank you for the article.


60 posted on 10/07/2023 2:33:29 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson