Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Bio battery based on cellular power plant
Chemistry World ^ | 27 August 2010 | Leigh Krietsch Boerner

Posted on 08/27/2010 5:19:17 PM PDT by neverdem

Leigh Krietsch Boerner/Boston, US 

Mitochondria, often called the powerhouse of the cell, have been harnessed in a new battery-like device that could one day power small portable devices like mobile phones or laptops. 

Mitochondria convert fatty acids and pyruvate, formed from the digestion of sugars and fats, to adenosine triphosphate (ATP), the cell's energy supply. Along the way a tiny electrical current is generated, and Shelley Minteer and coworkers from Saint Louis University in Missouri, US, have now harnessed those flowing electrons to put them to work in a new biological battery device.  

Speaking at the American Chemical Society national meeting in Boston, US, Minteer described how her team has built a biological battery that incorporates whole mitochondria capable of producing a current anywhere from microamps to milliamps per square centimetre, depending on the surface area of the mitochondria and the load density. 

Mitochondria

Mitochondria generate energy within cells, and could now be tapped in new bio battery devices

© Dr David Furness, Keele University/Science Photo Library

Minteer notes that commercially available batteries contain metals, and need to be recycled. However, battery recycling facilities aren't widespread in many areas.   'My research is about transitioning from these metal-based batteries to a biological battery,' she said. 'The living cell does energy conversion very efficiently.' 

Similar to a traditional battery, the bio version contains two electrodes. The cathode houses the conversion of oxygen to water, while the anode holds the immobilised mitochondria. 'Once the substrate comes in it can be completely oxidised to carbon dioxide, and when that happens, electrons go through the wire and do work.'

The bio battery is completely renewable and biodegradable, and is stable at room temperature and a neutral pH for up to 60 days. Minteer says the new batteries would be best suited to small devices that have intermittent use.

Right now, the test cell is in an open glass container in the lab, but for future commercial use, it would be in a hard plastic container. The fuel, any high energy dense liquid, would be added through a sealed, disposable cartridge that would be replaced as needed. 

In the future, Minteer wants to increase the surface area within the device so they can increase the loading density of the mitochondria because at the moment they're limited by the amount can put on the electrode. They're also looking at ways to improve the energy density output, and reengineer the size of the device to be as compact as possible. 

Evgeny Katz, an expert in biochemistry at Clarkson University in New York, US, describes this as 'an extremely interesting approach,' because the mitochondria can 'consume the whole biochemical, producing much more energy and power from the oxidation process'. He was also impressed with the very high stability of the mitochondrial battery. 'In most biofuel cells, the critical issue is not only how much power you produce but how long you can get it,' Katz explains.

 

Also of interest

Multiwalled carbon nanotube

Carbon nanotubes boost battery power

20 June 2010

Researchers in the US show how the carbon structures can improve the flow of lithium ions


Running on air

Running on air

The battery is enjoying a comeback as the star of a modern low carbon epic. Elisabeth Jeffries reports on the technologies being developed to store renewably generated electricity


Battery made from paper and algae

Super-thin batteries made from paper and algae

15 September 2009

Flexible, environmentally-friendly polymer batteries hold great promise for future technologies


Battery

Biological battery powers up

02 April 2009

Electrodes for lithium-ion batteries can be built upon a virus scaffold



TOPICS: Culture/Society; News/Current Events; Technical
KEYWORDS: battery; biochemistry

1 posted on 08/27/2010 5:19:19 PM PDT by neverdem
[ Post Reply | Private Reply | View Replies]

To: neverdem
a new battery-like device that could one day power small portable devices like mobile phones or laptops.

I wish I had a dollar for every time I've read that in an article.

2 posted on 08/27/2010 5:23:13 PM PDT by Moonman62 (Politicians exist to break windows so they may spend other people's money to fix them.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Moonman62

So... What should we do? Stop research into new ideas because it might not work?


3 posted on 08/27/2010 5:33:20 PM PDT by Ramius (Personally, I give us... one chance in three. More tea?)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Ramius
Image and video hosting by TinyPic

I think they should stop hyping research with very little commercial viability.

4 posted on 08/27/2010 5:39:55 PM PDT by Moonman62 (Politicians exist to break windows so they may spend other people's money to fix them.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: El Gato; Ernest_at_the_Beach; Robert A. Cook, PE; lepton; LadyDoc; jb6; tiamat; PGalt; Dianna; ...
Reanimated ‘Junk’ DNA Is Found to Cause Disease

Risks: A Warning on Asthma and Acetaminophen

Strip Mines into Elk Habitat

Digital Devices Deprive Brain of Needed Downtime

FReepmail me if you want on or off my health and science ping list.

5 posted on 08/27/2010 6:23:24 PM PDT by neverdem (Xin loi minh oi)
[ Post Reply | Private Reply | To 1 | View Replies]

To: neverdem; SunkenCiv
On the other hand, the production of protons and electrons from complete oxidation of glucose potentially encompasses a lengthy biochemical chain which possibly may be implemented using sets of immobilized enzymes in the manner of mitochondrial respiration. (Mitochondrial power density is 0.1 - 1 MW/m3.)

http://www.nanomedicine.com/NMI/6.3.4.5.htm
The problem is that you can not scale it up to sufficient volumes.

The next problem relates to engineering: How is the packaging to be done, this article is a good introduction http://www.northeastern.edu/bionano/bio-pdfs/J%20N%20N%20%20%20%20Bio%20Fuel%20Cells%20and%20Bio%20Batteries.pdf

6 posted on 08/28/2010 3:24:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson